MlSTS5026

Genetic marker
Map(s): Not Mapped
Forward primer: GGACATTGATTCTGAACATTTAGG
Reverse primer: TGGAACATCTTGTGACATGG
Tm: 58.9
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU174 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 104-421 bp
ATGTTTGAGGCTAGGCTTGTACAAGGTTCTCTTTTAAAGAAAGTTCTTGAGGCAGTCAAGG
ATCTGCTCTCAGAAGCACCATGGGACTGTAGTTCAACAGGAATAAGTTTACAAGCTATGG
ATTCATCACATGTTAGTTTAGTTTCTTTATTATTACGTGCAGATGGCTTTGATACTTACA
GATGTGATCGCAACTTGTCAATGGGTATCAACCTCAACAGCATGTCCAAGATCCTCAAGT
GTGCCTGCAATGATGATATAATCACAGTGAAAGCTGAAGATAATGCTGATACAGTCACTT
TCGTTTTTGAATCTCCAA

>Exon-2 422-574 bp
AATCAAGAAAAAGTCTCTGATTACGAAATTAAATTGATGGACATTGATTCTGAACATTTA
GG
TATTCCTGATACAGAGTACAATTGTGTTGTAAAACTTCCTTCGGCTGAATTCCAAAG
AATATGTCGAGATTTGAGCCAAATTGGTGATTCTG

>Exon-3 575-672 bp
GTTGTGATTTGTTGTACAAAAGAAGGAGTTAAATTCTCAGCCAGTGGTGATCTTGGATGTG
GTAACATCAAGTTAGCCCAAAGTACCAATGCTGATAAA

>Exon-4 673-812 bp
AGAGGAAGAGTCTGTCACTATTGAAATGAACCAGTCTGTTGTGCTGACATTTGCTCTGCGA
TATTTGAATTTCTTCACCAAAGCTACACCGTTATCTACTCATGTTACACTCTCCATGTC
ACAAGATGTTCCA
CTTGTGGT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: