MlSTS5024

Genetic marker
Map(s): Not Mapped
Forward primer: CACGCCATCAGAAAGCTACC
Reverse primer: TGACGGATTCTTCCTTTTCG
Tm: 60.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU168 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 32-70 bp
ATGGTGAAGTATTCGAGAGAGCCCGATAATATCACCAAAT

>Exon-2 71-111 bp
TCCTGCAAAGCTAGGGGATCCGATCTTAGGGTTCATTTCAAG

>Exon-3 112-342 bp
GAACACTAGAGAGACAGCGCACGCCATCAGAAAGCTACCTCTGATAAAGGCTAAGAGGT
ACTTAGAGGATGTGCTTGTCCACAAGCAGGCGATTCCTTTCACTCGTTTCTGCAGAGGTG
TCGGCAGAACTGCTCAGGCGAAGAACAGACATTCAAATGGACAGGGTCGTTGGCCTGTGA
AGTCTGCCAAGTTTATCTTGGATTTGCTCAAGAATGCTGAAAGCAATGCTGAG

>Exon-4 343-445 bp
GGTGAAAGGTTTGGATGTGGATGCTCTCTTCATATCTCACATTCAGGTCAATCAGGCACAA
AAGCAAAGACGGCGCACATACCGTGCCCATGGAAGAATCAACC

>Exon-5 446-513 bp
CCCTATATGTCATCACCTTGTCACATTGAGTTGATTCTGTCCGAAAAGGAAGAATCCGTC
A
AAAAGGAG

>Exon-6 514-545 bp
GCCCGAATCACAGTTGGCCTCGACTAACAAACC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: