MlSTS5016

Genetic marker
Map(s): Not Mapped
Forward primer: GACACCTTGTCTGAGCAAACC
Reverse primer: TGCACTCTCCAGTCTCATCC
Tm: 59.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU115 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 210-484 bp
CACCAGAAGCTGAAGACATCACCGACAGAATCTCGGTCACAGAAGCCATTGCAGACAAAGC
AGCTTTCAGAACATCTTGTGAACATCCGGGTTTCACTATCGAACGCACCTTGTCGAGGTG
TTCCTGCAGTTGTTTGATGCGGCCCATATAATCCTGATCCTCAACACAAAGAGTCACAGC
CTTAGTGTCGGCACCAGGACCATCAAACTGAAGTGGTCCTGGGTTTCTATATACATCTTC
CATCAAAAACTTGGTCGAATTTTGTCTTAACAACT

>Exon-2 485-588 bp
TCATAGGATTTGCCCTTCAAATCAACAGTTGCTGGATGCAGAGCTGGTTTTCCAAGGATTG
AAGCCCCGTGACCACGACCATAGCGCTTAACAGTCATCATAGCT

>Exon-3 589-705 bp
TGTTATAGGAGCAGCAGCACATCGCCACTTGTTCACAGGATTCTTTAAGTTGGTTAGAGTT
GCCATATAACCATTCAAACCAGCAGCAATTATGTGGTAGCCGATATGACCAAGCACA

>Exon-4 706-810 bp
ATAGGCAAAGTCACAATCAAATTTTGATGGCAATGATCCCCGAGCTTGATAACCAAAGAAA
TGGCAAATTGCATTGAATTTCTTTCCCTTATAGGTCCCTTCTTTC

>Exon-5 811-867 bp
CGTGCGCTTGTTCATTTCTGCTTCAACAAGATGAGCAAGGAGCTTTTCTGTTTCAATC

>Exon-6 868-912 bp
CTGAGATAGCTGTGCAGAGTCATCAGATTCTGGGTGAAGAAGGAGC

>Exon-7 913-1023 bp
CTGTTTTCTTATAAATGGAGGCAGGAACTCAAACAAGGCAGATGCCCAAGGTGATAGTTGA
GCAGAAATATTATCAGCAGAGACACCTTGTCTGAGCAAACCATGAATTTCC

>Exon-8 1024-1097 bp
CTGCAATAGAGCAAAAACTTCGGGGAAGCTTTCTATGAGCCCCTCCGGTAAAAGAATGACC
CCATGGTATTTATC

>Exon-9 1098-1191 bp
CTTGTTCAGCCCTAGCTTGAACTGCATCACATATTTGTTTTGTGATGTCAAAGATTGTAAG
TTTCGATGCAGCCACTTCTTCGGCAAGAATGACC

>Exon-10 1192-1272 bp
CATATTGGGATGAGACTGGAGAGTGCACTCCAATGCAACATGAGATGCCTTCCTCCCCA
TGAGTCGGATAAAATAATAATAC

>Exon-11 1273-1326 bp
CTTCTCTGCTGAGAGTGCATCAGTGCAGACATTGCTAATTAGCTGGGCATTAACC

>Exon-12 1327-1410 bp
CTTACAGATTGTGTCAAAACCCACATTTGTCTCAACAAATTGGTTTCTAAGATCTCCATTT
AAAGTAACAGGAATACCAACCACC

>Exon-13 1411-1415 bp
CTTAGT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: