MlSTS5015

Genetic marker
Map(s): Not Mapped
Forward primer: CCCATACTTTTGCATCATGG
Reverse primer: GTGGCTACTGCCTCTTTTGC
Tm: 58.8
Physical marker
Overgo sequence fw: ATAGGACCCTCTGGTAGCCAGTTC
                ||||||||
Overgo sequence rv:                 CGGTCAAGAGAAAGAGGTGGTTGA
Tm: 65.4
Set: E
Pools: 1,7,15
View Map
Sequence
Unigene: MlU104 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 169-235 bp
TTTATGCCAATTGCAGTGCTTCGTCGCGTTTTATGTCGAAAACCTTTACAAGGACATCTTC
AACAACC

>Exon-2 236-322 bp
CTTATCAGGAGTAGATGCACCAGAAGTTATGCCGATTGTGATAGGACCCTCTGGTAGCCA
GTTCTCTTTCTCCACCAACT
CACCATGC

>Exon-3 323-508 bp
CATCAACTTGCAACTAATTTTATTTCCAGGGCCTATTCTTTTCTCACTGTCGACCCAATAA
GATGGGATCCCACGCTCCTCTGCAATTTCTTGTAGGTGAGAAGTGTTGCTCGAGTTCCAA
CCGCCAACAACTAGCATCAGATCCATCTTTTCATCCACCAGTTTATACATTGCATCCTGC
CTTTCT

>Exon-4 509-603 bp
TTGAGTTGCATCACAGATAGTATTGAAACTCATGAAGTGGTTGTTAACATTTGTGACCCC
ATACTTTTGCATCATGG
TCCTCTCAACTAATTTTCC

>Exon-5 604-709 bp
CAATATCCTCTGTTTCACCCTTCAACATAGTAGTTTGATTTGCAATACCAACTTTTATAAG
ATCTTGGTCTGGATCGAATCCCTTGGACACAGCAAATTTAAATTTC

>Exon-6 710-784 bp
CTCAAGAAATGCCTCCTTGGTTGAGCTGGATCCATCAAGACCACCACCCAAAATGTAATCA
CATACATATGTTGCC

>Exon-7 785-916 bp
CTCTTTCATGTTCTTTACAACGATATACTTCCCTGCAAAAGAGGCAGTAGCCACAGTCT
CTTCATGAGAGTATTTACCATGGATAATTGAAGTATGCTCTCCTTTCTTGTGCTTTTCAA
CGGAATTCCAAACC

>Exon-8 917-999 bp
CTTCGATACCCAGGGGCAAGTTGTATCAACTATTTGAACATTCTTATCACTCAAAATCAAC
ATCTCATCCACAGCAGCTCCAAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: