MlSTS5014

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 48.60cM

Forward primer: CCTCAGAGCAAGCTGATCG
Reverse primer: CTGTTTAGGAGGACCGGAAGC
Tm: 59.8
Physical marker
Overgo sequence fw: CTCATTGAAGCTGCTTCCGGTCCT
                ||||||||
Overgo sequence rv:                 GGCCAGGAGGATTTGTCTTTAGCC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MlFPC1059
ML__Ba067F07
MlFPC1421
ML__Ba065F10
MlFPC294
ML__Ba017M16
ML__Ba008B17
ML__Ba049J23
ML__Ba018A14
ML__Ba009D04
ML__Ba026J17
ML__Ba007K11
ML__Ba092M05
ML__Ba087L07
MlFPC416
ML__Ba072P05
MlFPC731
ML__Ba069K24
Set: E
Pools: 1,7,14
View Map
Sequence
Unigene: MlU79 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 163-322 bp
CTCAAACTCTGAAACCTTTACTGTTTCTTCGACCTCTGGCCTTCTCAAACTTCCTACCCTT
GGAACGCACGTAAGGCTTGGTGTGACTGTCTGGAACACCAGGAGCTTTTCCAAAGTGCCT
CACTGCTTCACGAGCCTTCCTCGAACCTCTCAAGAGCACA

>Exon-2 323-505 bp
AGTGTTCTGTCCAAGAGGAGCCCTCAGAGCAAGCTGATCGAAAGTCAGACATTCACCGC
CAGCCTTCTCAATTCTAGCTCTTGCAGTCTCAGTGAACCTCAAAGCAGCAACCTTCATAG
CAGGGATTTCGTGCACACGAATGTCGTCCGTAACACTTCCAACGAGCACCGCAATCTGAT
TCTCC

>Exon-3 506-634 bp
CTTGCCCTTCATGAGTGCGGAAAGGCGGGAGAGAGATAGCGGAGGCCTGTTAACCCTACTC
ATGTAGAGCCTCTTCATTACAATCTCATTGAAGCTGCTTCCGGTCCTCCTAAACAGA
AATCGG
TACAAC

>Exon-4 635-726 bp
CTTCACGAGGAGCTTGATATAAACATCGTCGGATTTAGGGACGGTGCGCTTGGTTTTCTTG
CTCTTACCTCCGGCGACTAAATCAATACCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: