MlSTS5013

Genetic marker
Map(s): Not Mapped
Forward primer: CGTCCTTCTCCATCATCTCC
Reverse primer: GTTTTGGGGTGGTTTTATGG
Tm: 59.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU75 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 274-340 bp
GTCCACGTCTCAAGGAAGAAAAAAATCCACCAGATTTCTCCTTTCGTCCTTCTCCATCAT
CTCC
AACC

>Exon-2 341-475 bp
CTCCTTAGAAATTTTCTGCAAGGTTTCTGTTACTTGAGAAAAGTCAGGTCTTAAAGTTGGA
TCTTTCTGCCAGCATTTCTCAAGCAGATCAGCAAGCTTTGGATGCGTGTTTTTCGGAATA
GTTGGACGGAGACCC

>Exon-3 476-529 bp
CTTTTGGACCACTCCAACAGCTGCTTGTAAAGGGGTCAAGTAGTCGTATGGAAGC

>Exon-4 530-610 bp
CTTTCCTGTCAGCAATTCCCATAAAACCACCCCAAAACTAAAAATGTCAGCCTTGTGAT
CATATGGTTTATGCTCTATAACC

>Exon-5 611-706 bp
CTCGGGCGCCATCCATCGGTATGTTCCAGTTTCAGCTGTCATAACACCTGTTTGGGCTTTC
ACTCTGGCCACTCCGAAATCACCCACCTTAACTACT

>Exon-6 707-759 bp
TTCATTTTCATCCATCAAAAGATTTGCAGCCTTCAAATCTCGGTGAATTATATT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: