MlSTS5011

Genetic marker
Map(s): Not Mapped
Forward primer: CCTTGCCTTGAAAAGAATCG
Reverse primer: GCATGAGGGAGTGTAATGAGC
Tm: 59.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU68 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 221-227 bp
AATTGATC

>Exon-2 228-568 bp
CTGTGAAAATGGTGCACGAGCAGTTAGTAATGACTTTTGTTCCTTGCCTTGAAAAGAATC
G
TATGAATGGTTTTCTCGGAATTCTTCTTGAAGAACCTCCATAGGCATGGAGCAAAGTG
ACTCAATAGTTCCTTTGCTGGGAATATCTGGCTCACATCTTGTAGGCGTGGTGCCCGTTG
GCTCATAATCTGTGTATTTGTGCCTAAAAGTATCAACCGCATAATGTTCAATACAGGCTG
CTTGCTCGGAATGATCTCTGTCAAGGTTCTCGATTATTTCTGAATGAGCTCTAGCAGTCG
TCAGAATTTCAGAAACAGAGAGTTTCTCTTGCTCTGACATACC

>Exon-3 569-678 bp
CATCAAAGCAACGAATGATGTCTTCACCACTCTGTTGAGCATCTTCCTCGACTGTAGTTCT
CGCAGATTCAATCTCAACGTCATGTTGCTCATTACACTCCCTCATGCTCC

>Exon-4 679-780 bp
CTAACATGTGAAGCAATTGTTGTGGCATGCTGACTTCCCATGTCAGTCAGTGAGTTCTGGG
TTCTTTGCCACTGCTTCAAAGCTGTATCAGCAGTGTTTACAC

>Exon-5 781-986 bp
CATTTCTGCAGAAGTAACTCCATACGACAATGTTTAGCTGCAGAGAAGTCAGCATTATCAC
GAAAGCTACTTTCTGCTTGTGTAAAGCACTCCTGCCATTTTCTTTTTAGATCTGTAGTAA
TGCCGTCGACTGTTGAGGCATGTCCATCCAAAAACATCTTGTTTCCAACTACGCTATCAT
TAAGGTCACCAAGCCTTGCATCCACC

>Exon-6 987-1070 bp
CATCTCTTTCTGACGGCGCATACAGTTAGAAACTAGAGTTGTCATATCAGCAATAAGCTTC
TCTGCATCTGACTTGGACTGTTCC

>Exon-7 1071-1229 bp
CTCGTAAGCTTTCCGAAATTCAGTAATGCACTTTGTCTGAACTTCATCAACATGAGATGCA
TGACTTCCAAGCCTTTCTGATTCTTTTGAGAGCTTCCCAAGAAATCCATGAAGGGATTCT
GAGGTATTCGTTAAGTGCTCTATGCTAGCTTTAAACCTC

>Exon-8 1230-1337 bp
CTGTCGAAGCTCCCTCACTAAATGTGCCATTTCGCCCTGATGACTCGATAAAGTTTGTTGA
AGATCGTCAAAAACTGAATTCACTTCAACAGCCTCTTCAGCTAATAAG

>Exon-9 1338-1489 bp
GTCTACAATAGCCTGTGAGTTAGAAGAAGCCAAAGCTGACAGTTCATCCAAAGCCGCATTA
CTACCTGCATTGTGCAGCCTAACAACATTTTGAACAGCCTCAAAATGAGAGATGCACAAG
GCCTTTGATGTTCTTACTTTCTTCTTTAGTTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: