MlSTS5010

Genetic marker
Map(s): Not Mapped
Forward primer: CGTGTGTTCAATCATTTGTCG
Reverse primer: TTTTGGCAGCTCGTAAAAGG
Tm: 60.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU67 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 215-244 bp
TTCCTCCGGTAAAATATTGGGCAATCTCGAC

>Exon-2 245-324 bp
CTAGTGCAAAGCACATCCTGATGAAGAGAGCCTTGGCACTCCTGGCATTGTGTCCATAGCC
GACCAAAAAGCTCCTCTAGT

>Exon-3 325-399 bp
TTCAGCAACGTTAGATACAGACTTGCAATAAAGTTCAGCTTCTCTTCCTTTGCAGTGTGAG
CACAGGGTATGATTG

>Exon-4 400-567 bp
GGAGTTGCTAATCAAGGCCTTGCATCCAATGCAAGTTAGTTGCTTTTTAGCAAACTTCATG
ATGCCACTGTTTGACGGGGTAGAAATGGAAATTGATCTCGTATGACTTCCTTGAAGAAGC
TCTTTACTAGCATTTTTCAAAATGGGTTCAAAGATCCTCAACAATGGC

>Exon-5 568-657 bp
CTTGCTAATTTGATTTTCAAGATAGTAATTGGGGTCGATAGGAATGTTGTTTTCTAAAACG
TAGATGGGGTCCTCTGATTTTTCATAAGCC

>Exon-6 658-732 bp
CTTGGCACCTTTTGCTGCTTTAATAATGACATAAGGTACCCGATCACCGACATTTGGAGCA
GTAGCAGCATCTCTC

>Exon-7 733-804 bp
CTTGCGCATACGTTCTGCAAGCTCAACATGTGCTGCTTTCACTTCATAGTCTTCTCCTGTT
TTTGTCAGACCC

>Exon-8 805-977 bp
CTTGGTGATAACTAAAAGGGACAAATCCATGCGATTCATAAGGAGATCTGAGATTGTGTTC
TTGACATATTGAACTGCAGCAGGAATGTCTCTGTCTATCAATATTTTATTGAGGCATTCA
GTGACCAGGTTTTTTACCAGCAAACAGTTATCCCTACGAACAGTTTCAATCCC

>Exon-9 978-1092 bp
CTTTGGTCTCCATCTTGTCAAATTTCTGTGGGTTCGTCCAGTAAAGACCAGCATACCTCTT
CTTACTAATTAGTAGATATGGATAGTAAACCTTCTCAAACTCCAGTTTTATGGGA

>Exon-10 1093-1206 bp
ATTGATGAAAGTGCCGCTAATATAATCAGCAGCTTCCCTACCCAAATTCATGGCCGCATCC
ACTGAGGACACACCAAATTGCACCATAACTGAATCTGTATCTCCATATATGACC

>Exon-11 1207-1286 bp
CTCAGCATTGTGCTCGTAACCTCCGACCACAGTGAATTTATCTTCCACAAGTTTTTTCGT
GTGTTCAATCATTTGTCG
ACC

>Exon-12 1287-1374 bp
CATAGCTGGTAACACTTGAAGATATCTCCAAACAAGGTAACTGACCAACTGTAGCTCCAGT
GAAACCATAGACAGAATTTGCACTTATC

>Exon-13 1375-1431 bp
CTTCAAAGCGAGTTGTCTACCATCCAACACAGCTTTTTCGAGAGGATCCTTTGCTTCC

>Exon-14 1432-1472 bp
CTTCAAATCTGCTTTAGCCCTTTTACGAGCTGCCAAAAGTTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: