MlSTS5009

Genetic marker
Map(s): Not Mapped
Forward primer: TCGAGTCACCAACAAAGTCG
Reverse primer: ACACAGAAGGCGGTAGATGG
Tm: 59.9
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU62 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 270-322 bp
ATTTAGTGGCCGCCACCAATGCCATGTGCTCTATCAGGTCCAACACCCGGTTAC

>Exon-2 323-412 bp
CTGTAACCCCACTCGTTGTCGTACCACGAGACGAGCTTCATGAAAGACTTGCTAAGACCTA
TGCCAGCCTTAGCGTCAAATATGCTCGATC

>Exon-3 413-496 bp
CTCGAGTCACCAACAAAGTCGTTAGAGACCACATCTTCATCAGTGTACCCAAGGATGCC
AATCATTGGACCCTCCGATGCATACT

>Exon-4 497-639 bp
TTAATTGCTGCTTTAACATCATCATAAGAAGCACTCTTCTCGAGTCGAATAGTCAAGTCTA
CAACAGAGACATTAGCAGTGGGCACACGGAATGCCATCCCAGTGAGCTTTCCGTTGAGTT
CCGGAAGAACTTTTCCAACAGCC

>Exon-5 640-737 bp
CTTTGCAGCACCTGTGGAACTAGGTATGATGTTCTGCCCTGCTCCTCGGCCACCTCGCCAG
TCCTTCATCGAAGGGCCATCTACCGCCTTCTGTGTGGC

>Exon-6 738-798 bp
CTGTTGTAGCATGGACAGTTGTCATTAAACCCTCTAGAATACCAAACTCTTCATGTACTAC
C

>Exon-7 799-935 bp
CTTGGCCAGGGGAGCAAGGCAATTGGTGGTACAGCTGGCATTGGAGACGACATCCATGTCC
GGTTTGTAAGTGGTCTCGTTTACGCCAACCACAAACATAGGAGCATCAGGCGATGGAGCT
GAGATAACAACCTTTTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: