MlSTS5005

Genetic marker
Map(s): Not Mapped
Forward primer: CACTGATTGCACCAAAAACC
Reverse primer: CACAGCAAATCCTTCCATCC
Tm: 59.0
Physical marker
Overgo sequence fw: CGTTATCTTCGTCTGAATCTGCTG
                ||||||||
Overgo sequence rv:                 TAGACGACGACTAACCTAGTAGTG
Tm: 63.4
Set: E / F
Pools: 1,7,12 / 3,8,12
View Map
Sequence
Unigene: MlU43 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 114-274 bp
TAAACAAGATTTGGGCCTGTAAACCTTTGAAGAAACCTAGTATTCCTTCTTTCTCCCATAT
TGCACTGATTGCACCAAAAACCGTTTTACGGGTCTTCTTTTGGGCTTTATTGTCGTT
ATCTTCGTCTGAATCTGCTGCTGATTGGATCATCAC
TTTACACC

>Exon-2 275-435 bp
CTTATAGCAGGGTATGTTATACAGGTGGCGATGCATTTCGAGACTGCACCTAACATAAACG
CAGATAATGCAGAAAGTGCTTCTGGAGATGTTATATCGTTTCCCCGTTTTCTCATATTCT
CCTTCGATAGTCTTTGCTTTAACTGGTCAAATGCTGTATAC

>Exon-3 436-582 bp
CTGGATGGAAGGATTTGCTGTGAGAAGAAGAGAGATGCCAAGACCATCGAATGCCTCTG
TCCAAGTGCTCTCTGAGAGTGATTCCCAAAGCCCTTTCGATTTCCCAAATGCACTGGTTT
GCATCTTCGAAGATGCTGTATCCAGAGGC

>Exon-4 583-740 bp
CTGTGTCACTACGACTGTGCATGCACCAGCAGCAGCTGCTATGATCAAGTTAGCTTTAGTT
CCAATGGATTTGGATCCACTTTTCTTCAAGTAAAGCCGCTTTAGAAAGCTGTAAGCGTAG
AAATAAATGAACTGCGAAATGAAAGATTGGAAGTTCTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: