MlSTS5004

Genetic marker
Map(s): Not Mapped
Forward primer: GCACCACTAACTGCCTTGC
Reverse primer: CATAAGTGGCAGCCTTCTCC
Tm: 59.5
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU35 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 3-85 bp
CGATTGGTGGCAAGGGTTGCTCTTCAGAGAGACGATGTTGAGCTTGTTGCTGTCAATGATC
CCTTCATCACCGTCGACTACATG

>Exon-2 86-201 bp
GACCTACATGTTCAAATATGACAGTGTCCACGGCCAATGGAAGCACGACGAGCTAAAGGTT
AAGGATGAGAAAGCCCTTCTCTTTGGTGAGAAGCCTGTGACCGTTTTTGGCTTTAG

>Exon-3 202-301 bp
GGAATCCGGAAGAGATTCCATGGGGTGAAACTGGTGCTGAATACATTGTGGAGTCAACTGG
AGTGTTCACTGACAAGGACAAGGCTGCAGCCCATCTAAAG

>Exon-4 302-448 bp
GGGTGGTGCCAAGAAGGTCATCATTTCTGCACCAAGCAAGGACGCACCTATGTTTGTTGTT
GGTGTCAATGAGAAGTCATACACATCAGATCTGAACATCGTTTCTAATGCCAGCTGCAC
CACTAACTGCCTTGC
TCCATTGGCGAAG

>Exon-5 449-509 bp
GGTTATTAATGATAGGTTTGGTATTGTCGAGGGACTTATGACCACAGTCCACTCTATTACT
G

>Exon-6 510-750 bp
GCCACTCAAAAGACTGTTGATGGACCATCTGCCAAGGATTGGAGAGGTGGAAGAGCCGCCT
CATTCAACATTATCCCCAGCAGCACTGGAGCAGCAAAGGCTGTTGGCAAAGTTCTTCCAG
CTCTGAATGGAAAATTGACTGGAATGTCCTTCCGTGTTCCAACTGTCGATGTTTCCGTTG
TTGATCTCACTGTGAGATTGGAGAAGGCTGCCACTTATGACGAAATTAAGGCAGCTAT
CAA

>Exon-7 751-960 bp
AGGAGGAGTCAGAGGGAAATTTGAAGGGAATCTTGGGCTACACTGAAGATGATGTGGTGTC
AACTGACTTTGTGGGTGACAACAGGTCAAGTATTTTTGATGCGAAAGCAGGAATTGCTTT
GAATGGGAACTTTGTCAAGCTTGTTTCGTGGTATGACAACGAATGGGGTTACAGTACTCG
TGTGGTTGACTTGATTAAGCACATTGCCGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: