MlSTS5003

Genetic marker
Map(s): Not Mapped
Forward primer: CAAGAGTGGCTGATGTGACG
Reverse primer: CCTGTAGCTGCTCGTGAGG
Tm: 60.5
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU25 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 -1-21 bp
TG

>Exon-2 22-119 bp
GGTGTGTAACCATTTTGTGNAAGGAAGTCGTCTTTGATTAGTCGAGACACCTCCAAAGTGA
TTTTATCAGATTCTGCAAGGGAACCCTTGCCGACCAAT

>Exon-3 120-224 bp
TTGGACAATCTCTGATAAATCTTCTTCTTCTTGTAGGATTTCTTTGCACTTTGTTCTTAAG
GGCACAAATTCTGTGAAAGATTTGTCATAATATTCATCAAGGGCA

>Exon-4 225-311 bp
ACGCATGTATTTGCTGTAACTGATGAGCCAGTTGATAGAAGGGAAATGTTTACGCTGGGCC
AGTTTCTTATCTAAACCCCAGAAGACT

>Exon-5 312-506 bp
TTGTACAATACCAAGAGTGGCTGATGTGACGGGATCAGAGAAGTCTCCACCAGGAGGGG
ACACAGCCCCAACAATACTGACACTGCCCTCACGAGCTGGATTACCAAGACATTTCACCC
GACCAGCACGTTCGTAGAAAGAAGCTAGTCGAGCACCAAGGTAGGCAGGATAACCGGAAT
CTGCTGGCATCTCGGCC

>Exon-6 507-613 bp
CAAACGTCCAGAAATTTCTCTCAGAGCTTCAGCCCATCGAGATGTGGAATCAGCCATCATA
GATACGTTATAACCCATGTCACGGAAATATTCAGACAGGGTGATGCC

>Exon-7 614-743 bp
CTGTGTAGATAGAGGCCTCACGAGCAGCTACAGGCATATTGGAGGTGTTAGCTACCAAG
GCTGTTCTCTTCATAATACTCTCAGGATTTCCAGCAACTTCCATTGTCAACTTGGGGAAA
TCTCGCAATACT

>Exon-8 744-806 bp
TTCAGACATTTCATTACCACGTTCACCACAACCAACATAAATGATAACATCACTGTTTGAG
AAT

>Exon-9 807-908 bp
TTTGGAAAGGGACTGTGAGATGACAGTCTTACCACAACCAAAGGCCCCAGGAATAGCGGTC
GTACCTCCTTGGACACAGGGGAACAGAGCATCTAATACACGC

>Exon-10 909-980 bp
CTGTCCAGTTAAAAGTGGATAGTTGGCTGCAAGTTTATCTGCAGTTGGTCTAAGTTGTCTG
ACAGGCCACACT

>Exon-11 981-1037 bp
TTGTAACATGGTATATTTTGTCTTCTCTCCATCAAATTCAGTTTCCAATACAACATCG

>Exon-12 1038-1139 bp
GCTGCAGTCATACATACCAGGCTCAGCAATATAAGTCACCTTGCCTTTTGAACGTGGAGGT
AACATGAGTTTATGTCTGATCAATATATTTTCATATATGACA

>Exon-13 1140-1177 bp
ACCATAGATGTCACCACCTGTCACATGACTTCCAATCTT

>Exon-14 1178-1289 bp
TGACGTTTTGAGGTTCAAACTCCCACTTCTTGGAACGATCCAATGCAGGAGTATTGACACC
TTTAGGAATGTAGATACTGTCAGTCAGATCAGAGATGTCCTCCAATGGACGT

>Exon-15 1290-1346 bp
TTGAATACCATCAAAAATGCTGCCCATAATTCCTGGTCCCAGTTCAACTGAAAGGGGT

>Exon-16 1347-1402 bp
TTTACCTGTTCTCAAAACAGGGTCCCCTACAGTTACACCAGAAGTGTCTTCATAGAC

>Exon-17 1403-1529 bp
CTTGTATAGTAGCCATGTCTCCTTCCAGTCGAATAATCTCTCCAACCAGCTCGCTATGGCC
AACACGAACCAGTTCGTACATTGCTGCTCCAGACATGTCCTGGGCTGTGACCACAGGCCC
TGAAACT

>Exon-18 1530-1585 bp
TGCATAGACATAGCCATAGAGCTTTTCTTTCTCAACATCTCGAATTCTGGGTAGTTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: