MlSTS5002

Genetic marker
Map(s): Not Mapped
Forward primer: GACATGTTGTTTGCCTCTCG
Reverse primer: CATTCTCATCTGTCAAGAATTTTCC
Tm: 59.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU16 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 3-111 bp
CGTTGCGCATCGCGGACATGTTGTTTGCCTCTCGAAACTGTTGAACTTATGCCTTTGCA
CTGCAGCAGATTCTCTTTGACATGCTTGAAGAAGCTATTTTCCTTGAGCAG

>Exon-2 112-230 bp
GCTATGAGATAGGCGATTGGAATTTGTCTAGATCTGAAGTTAGCAAAATATCAATTATGAT
GCTGATGTCCAGATGTGACTTCATATTGGGAAAATTCTTGACAGATGAGAATGACTTG
G

>Exon-3 231-432 bp
GGTGAGCGTTCCTTGCCTCCAGCAAGAGTGGAAGAAGTTAAATTTGTTCTCAAGGAGCTTG
ACCGTCTTGTAATTCATCCAGACACAGCATCATCTCTTCCTTTACATCCTCACTTGAAGG
AGGGTGTTTCCGAGGAGACTCTGAGAAGACGCTCCCATTTGCTGGTTCTTTTTCCATCAC
TATGTGAACTTGTTATGTCCAG

>Exon-4 433-510 bp
GGGAATCGGAAGTTAGAGAGCTTGTACAAATATTACTTCGACTCGTTGCAGCAGAATTGGG
CTTAAAGAAGCTCTCAAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: