MlSTS5001

Genetic marker
Map(s): Not Mapped
Forward primer: AGCTTGGCTTTAGCAGTTGG
Reverse primer: TCACGAGTTCCTCCTTCTCG
Tm: 59.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU13 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 177-459 bp
CTCAAGCAGCAGCTCCAACTGGCGCAGCAGACTTGAGTCTGGATGACCCGTAGAGTGTTTC
TTCAAATCGAATAATCTCGTTTTTCGATCCGTAAGCAACTTGAGTCCTGTCATCAAGATT
AACAATGACTTTATCGAGCACAGATTGTTTTCCGTCACTGCTGAAACCGCCTGCCTTTTC
GATCAAGAATCCCAAAGGAGCCACTTCAAATAGCAGCCTCAGCTTGGCTTTAGCAGTTG
G
AGATATCACATTTGTGAATATTCCCTTTTCTTTCACAATGATC

>Exon-2 460-531 bp
CTGATTAACATCAGGCACCATTCCTCCTGTGTATCGCAACCTGTATTTCTCGCGGACATAG
TAGTCGATTAGC

>Exon-3 532-632 bp
CTTGGCATAGTCAGGGTTGTCAAAGGTAGCTCTCAAGTTACCAGGGGAAAACATTTTTCCT
TCTCCAATTGAGGTTGTGTCTTTCACATGTTGCCATTTTCC

>Exon-4 633-854 bp
CTTCATCGAGAAGGAGGAACTCGTGAGTCCCGGGAACATCCTTGAGAGCAAGAACATAA
GTGGTACGAGGACCGAAAATGCCCATAGCAGCAGCAACTTGTTGAGAACCAGTTACTCCA
GTAAGCTTGTCTCCAGGCCATACTCCAAATATTGTCCCTACTGTGAAGTTTGTGTCCACT
ATGCTCGATCCATCTAGCGGATCGAACGCTACACTGAATCCTCC

>Exon-5 855-936 bp
CTTCAACAGGTCCTCCCATATCTTGTAGCTCAGGGACTTCTTCGGAGCAAGCGTATTTGCA
GTAGTGAGAAAATTCTAATGCC

>Exon-6 937-1122 bp
CTCAAAAAGAAGTTTGTCGGCAAGCATATCGACAGCAAGTTGCTCGTCTCCAAAGCTGTTG
ACACAAGCAGTTCCTCCACAAGAAGCTGTTCTCACTTTGAATGCAATTGTTCTAAGTGCT
TCTCCCATGCACGTCATCAGCCTAATCAGCCCCTTATCCGTTGTCGATTTCTTCAGAAAT
TCTTCC

>Exon-7 1123-1242 bp
CAGGCTATCACCAATCTCACACTTAGTGACAAGGGAAGAATTCTTCGCCTTAACAATCCTC
GATGACGATTTTGGCGCAGCACGCAAGGATTCTCCGAACAGTGAGCTTGCTTTCAAACTC


>Exon-8 1243-1352 bp
CTTGGAGCTCGAATAAACGGAACGCGGTGAGGCGAGTGCAGCCGAATACTGTTGTGAAGAA
ACATTAGGCAAGATCGTTGAACGGGTACAACATGCAATACTAGTCTCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: