MlSTS5000

Genetic marker
Map(s): Not Mapped
Forward primer: AAATACAGGATGTTTTGCTTGC
Reverse primer: ATTAGGACCTGGTCGCTTCC
Tm: 58.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU10 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-15 bp
TATTAAAGCATCTGTT

>Exon-2 16-93 bp
TAAACTTATTGTTACATTGGTATAAAGATCATCACCTCGTCTTTCAAATACAGGATGTTT
TGCTTGC
TTTATAATAAAT

>Exon-3 94-153 bp
TTTGAGATCCCCAGGATCTCCATCTATGTGTGGTTCACCTTCAGCGATAAAAGGATGTTCT


>Exon-4 154-240 bp
TTGACCATCACGCATACCAGGTTCAATTTCAACTTCTAACAATTTTTCTTCTGGAACAAAT
TTGATATTGGGGCATTCATCACACACA

>Exon-5 241-357 bp
ATGTTGCTGTACCATTTGGAAGCGACCAGGTCCTAATTGTGTTGTAACCATTTCCATTC
GACAGTTGCACTGACGCTTTCCTTTAGCAGGTTTAGCAACTGGTTTGTACCTGATTACC

>Exon-6 358-475 bp
CTCTACAAAATTGCCTGAATAAAGTTCTTCTAAAGAGACTTCTAAATCCATAATGACATCT
CCACCACGGACTACATCAGGTGTAGGATCTTTGCCAAAATGAAAATTTCCAAAAAAAC

>Exon-7 476-575 bp
CTTGAGAAAGGATCACCACTCATATCCCCTTGTTTTAAACCTTCCTCACCACGACGATCAT
AAATTTTTCTCTTCTCAGGATCTGAGAGTATCTCATATGC

>Exon-8 576-724 bp
CAGCCCCCAAATCCTGAAATTGATCTGCAGCTTTGGGATTATCTGGATTCTTGTCAGGATG
CATCTCTTTAGCCTTCTTTCTATAAGCCTTCTTTATGTCATTTAGTGATGCTGATTTTGA
AACACCAAGTATTTTATAGAAATCTCGTC

>Exon-9 725-767 bp
CCAGCCATGACATGCAGAAACATAAGAAAGATGTTGAGACACAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: