MgSTS98

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)1 5.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 4.70cM

Forward primer: TCGGACGGTCTTCTGTTCAT
Reverse primer: GTGATCCAATCGTCCTCGTT
Tm: 0.0
Physical marker
Overgo sequence fw: GGTCCACTTGACAGCTGAATCTTT
                ||||||||
Overgo sequence rv:                 CTTAGAAATGGTATTCACCTGAGG
Tm: 64.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2636
MG__Ba029D20
MG__Ba053B24
MG__Bb095K12
MG__Bb083N14
MgFPC345
MG__Bb022A23
MG__Ba012J20
MG__Ba086C23
MlFPC1890
ML__Ba068B12
MlFPC747
ML__Ba068D09
MlFPC781
ML__Ba018D06
MlFPC935
ML__Ba028N24
ML__Ba073M14
ML__Ba073N22
ML__Ba053M21
Set: A
Pools: 2,9,12
View Map
Sequence
Unigene: MgU163 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 168-361 bp
TTTATTTCTTCTTGAAAAGGAAATGAGCAACCATCCATTCTTCTCCATTGTTGTAGCCGAA
CAATTCCGCAACCGCAATGAAAAATGTTCTCCAATAGACGGTCCACTTGACAGCTGAAT
CTTTACCATAAGTGGACTCC
ATTAATGGCTTTATTGAGCTCAAATTCTGGTCCATTCTC
TTAAGCCATTCTTCAC

>Exon-2 362-420 bp
CTTGTCTGTGCATAATGCTTGCCATTCACAAGCCAGTGATCGACTAtAGAAACGTCATCC

>Exon-3 421-504 bp
CTGAAAGTAAAGGAGCAGGTCTGCTGAGGGCATTGTACCTCCAGTAAAGAAGTACCTAGT
GATCCAATCGTCCTCGTT
GACATCC

>Exon-4 505-615 bp
CTCAAAGTGGTAAGCAAATGTTTTATGGCAGAAATAATGGATGAACAGAagaCCGTCCGA
TTTCATCCACTTGGATATCTTCTTAAGAAGATCACGGTAGTTTTTCATATGC

>Exon-5 616-715 bp
CTCAAACATTTCAATGGAAAATATTCTGTCATAAGAAGCTTCCATATCAAACGTGCtGaTA
tCTccaacaaCTATCTCCACATTCTTTACTTGAAGATCCC

>Exon-6 716-1050 bp
CGACACTGCTCCTCGATGTGTTCcTtntGGGTAATGGAATTGCAAATCCCTTTGATCAGGC
AATTGGGGTATTTCTGAGCAATGTATAGGGAAAGAGATCCCCAGCCACAACCGACATCGA
GAACGGAATGACCGTCTTTtATCTGCGATCTCTCACAGTACAACTCAAGCATTGCCTTCT
CGGCATCGTCTAAAGTGCTTGACTTATCTGAAAAATAGCAGCAACTGTAtntGAGATGTT
TGCCGAGGGCAAGCTTGAAGAAAGATGTAGGAANCTTCGTAATGTTGAGACTTTGGCGTT
TCTGTCTGGATTGCTATCGGCATTTCTTTCAAAGA

>Exon-7 1051-1236 bp
AATGCACAAAATTGAGGAGATCGGACAGCTGGATGTCGGCGGAGGATCTGTAACCGGAGCG
GAGGCGACTGGCGAGAAGGAGCCGAGTGAGGCGGCGCACGACGGCGTCGGGCAACAGATT
CCGCTCGAGCGAACCGAGCATGAGGCGTACGGTGGCCTCGTAGGGCACCTGGACAATCGA
ATCCAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: