MgSTS95

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 9.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 5.26cM

Forward primer: TTGGGGAACTCTGTCGGTAG
Reverse primer: GCCACCAGAACAATTGAACA
Tm: 0.0
Physical marker
Overgo sequence fw: AAACAAATGCATCCAGTGCCCCTT
                ||||||||
Overgo sequence rv:                 ACGGGGAAGTAGGTCACGGCCAAA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2720
MG__Ba054J11
MgFPC2721
MG__Ba052N12
MG__Bb071P08
MG__Ba045G07
MG__Bb072N11
MG__Bb042J16
MG__Ba060I12
MG__Bb065E09
MG__Ba012P24
MG__Ba095J17
MlFPC1162
ML__Ba079E03
ML__Ba003H17
ML__Ba003I22
ML__Ba003P17
ML__Ba093A08
MlFPC609
ML__Ba079P22
Set: A / 3x3x3
Pools: 2,9,11 / 1,8,11
View Map
Sequence
Unigene: MgU141 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 104-410 bp
GAAGAGAAAGATTAGCCAACCATGGGAGCAACTTCTCATGGACCAAATCAGGCTTGTCATC
ATGTGGACAATGTCCAACTCCTTCCAATAAAAACAGCTTCACGTTCGTCAGTCGATCAGC
TAACGAAGTAAAGTATTTACCAACCGGCCCGTCAATCGGTGTAAACGGATCTGCATCGCC
CCATAACACCAAAACGGGTAGGGTGATATTCGGGATCAAATTCACTGGATTCGGTCCAGG
TGGTCCTGTGATAATCGAAACAAATGCATCCAGTGCCCCTTCATCCAGTGCCGGTTTC
CTAATAATC

>Exon-2 411-480 bp
CTCCACAAGATCTTCATCAACGGATTCCTTATTCCCGTagaCGGACAATAACACATTCCTC
AGCGTCtctC

>Exon-3 481-658 bp
CTTTGTCTAACACGGTCGAATAAGTAAGaAGCAATTCCTCTTTGCTTCAATAAGaaGTCGA
AAAACCAAAGCAAAGGTaaGAGTAGCTTTATTCTCCAGTCATCaacTAtAGCCTTGTTAT
TCATGCCACCAGAACAATTGAACAGCACGAGCCCTCGTACTTGCGATTGGCTAGATTC


>Exon-4 659-752 bp
CTGAAGCGGCAATAACGCAAGCAAGACTACCGACAGAGTTCCCCAATAGCACAGTTGGC
CTTTGGACAATttCGTcCAAGAAATCGAGAATCAAC

>Exon-5 753-864 bp
CTGAGCCCAGATTTCCATGGTGTACTGAAAGCCCGCGGGCTTATCTGAAGCACCAAAACCG
ATGAGGTCAATGGCGTAAACTGTCCGATTTTGTGCAAGCGTCGGAATATTCC

>Exon-6 865-1106 bp
CTGCGCCAATGAGCAATCGACGCGCCAAAGCCATGGACGAGAAGAAGCGGAGGAGCCGGAG
CAGCAGCGCCACCACCGCCGCCGCCGcngTCGCCGTCTGGGTAAACGAAGTAGTTAATGG
TATANTCCTCTCCACACCCATTTTTTGCAGTTGCCATCAATTTCGCTCACCTCCAGAGGA
GGCAAAAACTCCTCCTTTCCGGTGGATAGCGCCGCCGTGGATGCGGCGGAGACATTAGCA
CA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: