MgSTS94

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 103.67cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 16.84cM

Forward primer: GCTGGGGTTATTGTGAATCC
Reverse primer: TAGGCCACAAATCAGCACAC
Tm: 0.0
Physical marker
Overgo sequence fw: ATCAGCACACTCCTTTCCAATAGG
                ||||||||
Overgo sequence rv:                 GGTTATCCTGGCCACTACCGTCTA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1400
MG__Ba086G14
MG__Bb007C07
MG__Bb014G02
MgFPC1765
MG__Bb081P04
MG__Ba088C11
MgFPC2307
MG__Bb061D14
MgFPC251
MG__Bb088C16
MG__Bb094I16
MG__Ba010L04
MG__Bb021N08
MG__Ba021N19
MG__Bb085I21
MG__Ba001K24
MgFPC2857
MG__Ba015E13
MgFPC2858
MG__Ba023P14
MG__Bb028B03
MgFPC3005
MG__Bb066K23
MgFPC3118
MG__Ba094C23
MG__Bb067D14
MG__Ba010P12
MG__Ba091H21
MG__Ba030P11
MG__Bb015D22
MG__Ba051G04
MG__Ba048O09
MG__Ba085L15
MG__Ba020E11
MG__Bb095L21
MG__Bb015E02
MG__Bb040E12
MG__Ba012G20
Set: B / C
Pools: 1,7,12 / 5,6,15
View Map
Sequence
Unigene: MgU133 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 181-264 bp
TCTAGACAATGGCGTTGGCGGCACTTGCAATCCTAGGCCACAAATCAGCACACTCCTT
TCCAATAGGACCGGTGATGGCAGAT
CC

>Exon-2 265-306 bp
CTTTCATTTCACCCTTAGGATTCACAATAACCCCAGCATTATC

>Exon-3 307-591 bp
CTTCGAAGTACATGAAGACACCGTCCTTTCGGCGCCACGGCTTGCGCTGGCGGACGATGAC
GGCGGGCATGACCTTCTTACGGAGCTCAGGCTTTCCCTTCTTCACGGTGGCCATGACCAT
GTCGCCGACGCAGGCCGACGGAAGCCTGTTCAGGCGACCCTTGATCCCCTTCACTGAAAT
GATGTACAGGTTCTTCGCCCCGGTGTTGTCGGCGCAGTTCACCGTCGCCGCCACCGGCAA
ACCCAGCGACATCCTGAACTTGTTACCGGCCGATCCTCCGCGCCC

>Exon-4 592-603 bp
CTCGCTTCGACAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: