MgSTS93

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 12.00cM
M. guttatus IM62_x_DUN RILs(2009)11 2.88cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 6.61cM

Forward primer: GCTCAAGAATGCTCCCATGT
Reverse primer: CACGTCCAACACCAAGTGAC
Tm: 0.0
Physical marker
Overgo sequence fw: GCCCCTGATGAAAACATGCTCTAG
                ||||||||
Overgo sequence rv:                 ACGAGATCAACACTCTCGAAAGGT
Tm: 64.4
Contig BAC
BAC contig and clones containing marker:
MgFPC151
MG__Bb038M06
MG__Bb078F03
MG__Bb083P22
MG__Bb068J17
MG__Bb065L15
MG__Bb037G17
MG__Bb039N08
MG__Bb078D05
MgFPC1521
MG__Ba087K12
MG__Ba060I15
MgFPC1692
MG__Ba045N04
MG__Ba021K06
MG__Bb069H18
MgFPC2534
MG__Bb047P12
MG__Bb058F04
MgFPC981
MG__Ba023C05
MG__Bb002L15
MlFPC1
ML__Ba020G01
ML__Ba015N04
MlFPC109
ML__Ba085J17
ML__Ba059H13
ML__Ba053I18
ML__Ba035C10
ML__Ba074M01
ML__Ba057B18
ML__Ba079E06
ML__Ba075J01
ML__Ba026B04
ML__Ba057C24
ML__Ba079A21
ML__Ba083B21
MlFPC184
ML__Ba018K14
MlFPC746
ML__Ba015G20
MlFPC931
ML__Ba021L18
Set: A / 3x3x3
Pools: 2,8,15 / 1,7,15
View Map
Sequence
Unigene: MgU132 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 357-423 bp
ATCACCTCCGAACAGGTGGCACAGCCCCCCTGCCAGGTGGAGCACCGCCACGACCAGTAGC
TTGGGCC

>Exon-2 424-480 bp
CCTAGCTCGCATTGCAACCGCACGCCCACGTCCAACACCAAGTGACGAGCCCTTGCCC

>Exon-3 481-547 bp
CTTAATCCTAGCTTCTAAACGCTTAAACATGGGAGCATTCTTGAGCATATCTGGGATTA
CCATGAACC

>Exon-4 548-600 bp
CTGACTTTGCTGCCCCTGATGAAAACATGCTCTAGTTGTGAGAGCTTTCCATCC

>Exon-5 601-758 bp
CTTAGCGGTGTAAGTGATGTTTTCGAGCTGGCAATTCCAGTTATCCTCGCACTCGATCATA
CTTCCCCGATACAGTTCGCCGCTCTTCAGCTCCACCGTCACCACGTGTCCCGACGCCTCG
TGCAGCAGCTTCACCGGAATTCCTAAACTCCGACTCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: