MgSTS92

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 85.57cM
M. guttatus IM62_x_DUN RILs(2009)2 77.27cM

Forward primer: CAGCTCGTCGAACTTTGTCA
Reverse primer: TTGGTTCATCGATCTCCACA
Tm: 0.0
Physical marker
Overgo sequence fw: GACTAGGCCTCGGACTTGTTGGAC
                ||||||||
Overgo sequence rv:                 ACAACCTGATACAGCAAAACCTGA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1914
MG__Bb088I21
Set: D2
Pools: 3,10,11
View Map
Sequence
Unigene: MgU128 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 223-1029 bp
ATTAAATAGCGTACGATCGCGTGCACACAGTCTCGagaGCTTCGgtCATCAAGTTCGAAAA
GCTCgtcaTaGCCtgAAAAACTCCAGGCAGGCCCGTCTGGATATTATTCAAAGTCATGGC
tCTAGTAACCTCGACAGCCCTCgAgTGTTTCACCATTTCGTcCTCCACGCGCCtctGgca
gttcgagaGCTCCGccttcttAtCcGCCAGCGGGTCCCgcgAGTCCaaaGCATGGCCCTC
GtgggAACCGCCGCCgTCTGGCAGCCCGATCCCGACCATGGAATACGAggggtagtaCTt
ctTCTCGATGGTcCTCaAagaagatgCCTTCCTCTCGAGCTCcTtcgacGCggtCTCTGC
GCGTttCttgATCTTGATTTCtTCGGATTGTTTTAGCGATATCGAGTggaCGACGTTGAT
GAAGCTCTTTATGGCTTCGgACGCGACTGtgtctGGGATTCTGTCGAGGGCGAGTTTCCA
CTCGTCGCAGAAGGTGAACACGttGGACAGCTGGCGGTCTTcgACGGGCTGTTGTTGTTC
GGTGGTGGTGGAATGGATGGGGATTAGGGTTAGTTTGAACCAGGAGTGGAGGGATTGGAG
GAAGCCGCGTTGGAATTTGATGAGGCGGCAGAAGCTGGAGTGCCAGGCGGTGATGGCGGA
CTCAAGGTCACGGGTGGCTTGGCGGTGGAGATCGGAGGTTAGTTCGGACTTGGTGGCGGT
GTGGCTGACTAGGCCTCGGACTTGTTGGACTATGTCGTTTTGGACTNTCGTGGAATT
GGTTCATCGATCTCCACA
TGTACATGAACC

>Exon-2 1030-1237 bp
CCGTGACAAAGTTCGACGAGCTGCGGTACAAGATCAGAGTCTCGTAGACCGATAATAGC
AGACGAGGTAGTCGACACAGCCTGAGAAGTCACCACGATAAGAGACTGAAGCCTCGTTAT
CGATGCCTTCGTCTTGTCCACCTTGGCTTCCTCTTCTCCACGGTACTCTTGACTTTGAAG
CGAAGACAGCTTTCTGTCGTGCTCGATTTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: