MgSTS91

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 17.80cM
M. guttatus IM62_x_DUN RILs(2009)11 11.82cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 15.11cM

Forward primer: CTCATGTCCAGAGACGAAGC
Reverse primer: AGGAATCCCAAATCGAGAGC
Tm: 0.0
Physical marker
Overgo sequence fw: CTGGGTTTCTTCTCTACAAGGAGC
                ||||||||
Overgo sequence rv:                 GTTCCTCGAACCATCCTCCGAGTT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1262
MG__Ba024P05
MG__Ba022J19
MG__Bb056I01
MgFPC684
MG__Ba091H15
MG__Bb004E09
MG__Bb038D16
MG__Bb092O13
MG__Bb092B22
MlFPC109
ML__Ba074F14
ML__Ba003I06
ML__Ba088D12
ML__Ba025C03
ML__Ba015I09
ML__Ba059F14
ML__Ba031L07
ML__Ba090C15
ML__Ba030J16
ML__Ba021E23
ML__Ba025P03
ML__Ba059P06
ML__Ba008P12
ML__Ba003A12
ML__Ba077B17
ML__Ba090G14
MlFPC1441
ML__Ba015E23
MlFPC769
ML__Ba021I09
Set: A / D2
Pools: 2,8,14 / 4,8,12
View Map
Sequence
Unigene: MgU119 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 45-502 bp
ATGGCAGCAGAAATGGCGCTCCTGAAACCCATTTCCAAGTTCAGCCCAAGAATCGGGACCT
CAACCCGAGCCCCATGCACGAGGTTCGCCACCGTGAGAATGTCGTCCGCGGCGGCGCCGC
CGTCAGCTCCGGCGAGGAACAGCAAGAAGGGACCGAAGAAGGAGATAAAGGAGACCCTTT
TGGCGCCGAGGTTCTACACCACCGACTTCGACGAAATGGAGCAGCTCTTCAACACGGAGA
TCAACCAGAACCTGAACATGGCGGAATTCGAGGCGCTGATGCAGGAATTCAAGACAGATT
TCAACCAGACACACTTCGTTAGGAACAAGGAGTTTAAGGAAGCCGCCGACAAACTCGAGG
ACCCGTTGAGACAGATTTTTGTTGAGTTCTTGGAGAGGTCTTGCACTGCTGAATTCTCT
GGGTTTCTTCTCTACAAGGAGCTTGGTAGGAGGCTCAA
G

>Exon-2 503-567 bp
GAAAACCAACCCTATTGTAGCAGAGATTTTCTCTCTCATGTCCAGAGAcgAAGCCCGTC
ACGcacg

>Exon-3 568-693 bp
ggtTTCTGAACAAAGGTTTATCCGATTTCAATTTGGCTCTCGATTTGGGATTCCTAACa
nagGCAagaaagTACACCTTCTTCAAGCCTAAGTTCATCTTCTACGCAACTTACTTAtcc
gaaaagat



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: