MgSTS90

Genetic marker
Map(s): Not Mapped
Forward primer: TACTGTGGGGATCAAACGAA
Reverse primer: CTGGGAGAGCTTTCTCTCGT
Tm: 0.0
Physical marker
Overgo sequence fw: GCTGATGCTTTTCTAAGAGCCGCC
                ||||||||
Overgo sequence rv:                 CTCGGCGGTAGAGGGAGTTTCTAG
Tm: 65.4
Set: D
Pools: 2,10,12
View Map
Sequence
Unigene: MgU721 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 185-255 bp
GATCCGACGGCTACAAACCTCTCTCTTCCAGCTGATGCTTTTCTAAGAGCCGCCATCTCC
CTCAAAGATC
AG

>Exon-2 256-440 bp
GGTGGTGGAAATGACTTGGAGAAGACGAGGGGGAAAGGGCAGTTTGGACCCGACGGTGTAT
ACCGGTTTGATGGGGACGGCGTTCACGTGCTTGCGGTCGTATGAGGCCACCGGCGACCAC
CGCGATTTGCGGCTGTGCGCCGAAATTGTTGACGCCTGCGCCGCCGCTACTCATATCTCC
AACAG

>Exon-3 441-552 bp
GACATGTTACTTTTCTTTGCGGTAGAGGAGGGGTTTATGCGCTCGGTGCCATTACTGCAAA
TTACTGTGGGGATCAAACGAAGCGTGATTTCTATTTAGACCGATTTCTTGAG

>Exon-4 553-679 bp
GATGGCACGAGAGAAAGCTCTCCCAGTGGGACCCGAAGAGGGAGGATTCGGGATGTCAT
ACGATCTTCTATACGGGCGGGCCCGGGTTTCTTTGGGCCCGCCTCATTTCTGAACAAACA
CTCTGGAGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: