MgSTS9

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)5 55.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 44.75cM
M. lewisii x M. cardinalis(2009)2+4 46.30cM

Forward primer: TTAAGACCGTCCGCAAATTC
Reverse primer: TCCCTTCTCGAACAGCTCAT
Tm: 0.0
Physical marker
Overgo sequence fw: CGGCTTCTGAAACAGCGTGTAGAC
                ||||||||
Overgo sequence rv:                 CACATCTGTTTCGAAGAGTCGTAG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC246
MG__Bb048M23
MG__Ba022G03
MgFPC2768
MG__Bb043K09
MlFPC10
ML__Ba030I05
MlFPC20
ML__Ba018N22
MlFPC48
ML__Ba006O13
ML__Ba044M02
ML__Ba004P17
ML__Ba046E18
ML__Ba035B23
ML__Ba004K02
ML__Ba017K12
ML__Ba017N10
ML__Ba093G06
Set: D
Pools: 1,7,13
View Map
Sequence
Unigene: MgU242 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 190-314 bp
ATCAAGACGAACGAGACGATTCATCGCTTGACTCCGgTGCATCTGTGCCATCGATCATTTT
CTCTAGTGAATCAAGATCGCCGGCTTCTGAAACAGCGTGTAGACAAAGCTTCTCAGCAT
C
TTCAT

>Exon-2 315-376 bp
TCTGCAACCCCAAATATCTCTTTAACGGTTAAAGAACTGTCTTTTGACCCGAACTCAGGCA
GC

>Exon-3 377-474 bp
CTcaaacaAATAATAAACCTTCCCAAAAAGAGCTTGCACGGCAAGTTTTCTTTTGAAACCC
GTTTCTGAATATCCTGACATATCCATTACCACCGGACC

>Exon-4 475-652 bp
CTTTGTCTTTCACTATCCTTCTTGAAATCTCATACAAAATGACAGCTACTTGAGAATCATC
CAACATTAGTTTTTTCCTGAGCTGGATTAAGTTAGATATCAAATCTGGATCAAATGGCTT
CTCGTTCAACACATAGCGAATGTATTTCCGTAAAATCTCCTCCGTGTCAAAACCTGTC

>Exon-5 653-751 bp
CTTTTGCATCAGTCCCTTTAAATCTGATTGGTCCACTTCATTCATTCCCTTCTCGAACAG
CTCAT
CTATTGACTTGCATATCACAACATTTTTATTGATC

>Exon-6 752-1026 bp
CAGCTGGCGGCGTTTCTCCCTCGGCGAACCGAATTTGCGGACGGTCTTAACAAAGGCAA
TGACGAAAGTGACGCCGAGATAAGCCAACGGCACGGCCAAAACCCACGGCAGGGAGCTCC
GGCCAACGCGTGGGCCAGGAATTGCCTGAGAGACGGAGCCGGTGAACTCGACCAAATCCA
GAGCCTTCTCCTGAATCCACGGCAAATCCTCCTCCACTTCCTCCTCCTCCTCCGCCGCCN
AGCTGTTCCTTTTTAGTGGAAATGTTGCTGCTCTTAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: