MgSTS88

Genetic marker
Map(s): Not Mapped
Forward primer: ACCACTTATCAGGCGGTGAA
Reverse primer: CCTTTCCAAGCATGACTTCC
Tm: 0.0
Physical marker
Overgo sequence fw: ATATGTCCTCTGCGCCTTGGTACT
                ||||||||
Overgo sequence rv:                 AACCATGAACTTACGTCTCTCTGG
Tm: 65.4
Set: D
Pools: 2,9,15
View Map
Sequence
Unigene: MgU686 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 119-133 bp
ATGGCGACTGCATCAG

>Exon-2 134-297 bp
GTGGCGTTTAAGTCGAGGGAGGACCACAGGAAACAGCTTGAGTTAGAGGAGGCCCGTAAGG
CTGGGCTTGCACCTGCCGAAGTGGATGAGGATGGAAAGGAAATTAACCCTCATATTCCCC
AGTATATGTCCTCTGCGCCTTGGTACTTGAATGCAGAGAGACCG

>Exon-3 298-410 bp
GAGTTTGAAACATCAAAGGAAGTGGAAATCGGATCCGAACTATACCAGGTCCTGGTATGAT
AGAGGTGCAACCACTTATCAGGCGGTGAAGTTCAGAAAGGGTGCTTGTAAAAA

>Exon-4 411-677 bp
ACTGTGGGGCTATGACACATAGTAGGAAGTCATGCTTGGAAAGGCCTCGAAAAAAGGGA
GCCGAGTTCACTGGCAGAAATATTGCCCCAGATGAGAAGATTGAGTCCTTTGAGCTTGAT
TATGATGGAAAGCGAGACCGCTGGAATGGATATGATGCTGCATCTTATAAATACGTTATT
CANAGGTATGAAGCTCGGGATGAAGCAAGAAGCAAGTTCTTGAAGGAGCAACAACTTANA
AAGTTGGAGGAGAAAAATAGTAATCAAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: