MgSTS87

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 69.10cM
M. guttatus Irn Mtn Combined(2009)11 0.00cM

Forward primer: CTTCGACGATGCAGAGAGTG
Reverse primer: ACATAAGCCCTCCTCGTGAA
Tm: 0.0
Physical marker
Overgo sequence fw: GCATATGCAAGCGGCAGAGCAAGA
                ||||||||
Overgo sequence rv:                 CTCGTTCTTAGAAGAAGCCAAACG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC20
MG__Bb068C19
MgFPC570
MG__Bb094P09
MgFPC814
MG__Ba045M13
MlFPC1088
ML__Ba069N07
MlFPC132
ML__Ba023A16
MlFPC237
ML__Ba045N14
ML__Ba082B03
ML__Ba063N07
ML__Ba003P07
ML__Ba014K13
ML__Ba062C16
ML__Ba044F24
ML__Ba030P13
MlFPC743
ML__Ba017A16
Set: A
Pools: 2,8,13
View Map
Sequence
Unigene: MgU684 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 225-381 bp
GTTTGGACGACGGAGGAACAAGCGACTTTGCATATGCAAGCGGCAGAGCAAGAATCTTCT
TCGGTTTGC
TAACATAAGCCCTCCTCGTGAAATTGTTGTAGTCGTTCGCTTCTATCT
CGTCCAGTATTTGTCTATACAGAAGCAACGATGCCCACACA

>Exon-2 382-574 bp
AGGCCATCTACTAGCTGCGCTTAGCTCAGTGACACCACTCTCTGCATCGTCGAAGAATT
TCCTCGCCCTAGCAATTTGCTTCTTCATAAAATTTCTCCATTTATCCGTCACTTTCCCGG
CGAATATATCTTCATCGGATAGTCCCGCCTGCGCCAGCTCATCCTGCGGTAGATACACTC
TTCCTCGCCTCGCAT

>Exon-3 575-662 bp
TCTTCACCAACATCTCGGAGAATATTGGTCAACTGATTAGCCAGACCTAAAGCCAAAGCAG
CATTATACACACTCTCCGTTGTAGCCTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: