MgSTS859

Genetic marker
Map(s): Not Mapped
Forward primer: aaagagaatagagaaccaaacaa
Reverse primer: gatattgatcaaacatctgtttt
Tm: 0.0
Physical marker
Overgo sequence fw: CAGTACTCAGAAACTCCATGAACA
                ||||||||
Overgo sequence rv:                 GTACTTGTGTAGTCGGGGAGGTAG
Tm: 65.4
Set: C
Pools: 4,8,12
View Map
Sequence
Unigene: MgU5912 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 1-184 bp
GCTCGAGGGAAGATCCAGATAAAGAGAATAGAGAACCAAACAAACAGGCAGGTGACGTA
TTCAAAGAGAAGAAATGGTCTGTTCAAGAAAGCCCATGAGCTTACTGTTCTTTGTGATGC
CAAGGTTTCCATTCTCATGATTTCCAGTACTCAGAAACTCCATGAACACATCAGCCCCT
CCATC
AC

>Exon-2 185-190 bp
CGTCAGT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: