MgSTS857

Genetic marker
Map(s): Not Mapped
Forward primer: acggagccgggggaggtg
Reverse primer: ctcattttgtatatttaaaaatagat
Tm: 0.0
Physical marker
Overgo sequence fw: CCGCGAGTTCTTGATCCAAGTTCA
                ||||||||
Overgo sequence rv:                 GTTCAAGTCTTGTAACGGTTCCTC
Tm: 65.4
Set: C
Pools: 4,7,15
View Map
Sequence
Unigene: MgU5910 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 1-149 bp
CATCCGTTTATCGTAACGGAGCCGGGGGAGGTGGCGCGTGGGAAGAAGAACGGACTTGA
TTACCTGTTCCATCTGTATGAACAGTGCCGCGAGTTCTTGATCCAAGTTCAGAACATTG
CCAAGGAG
AGAGGTGAAAAATGCCCTACCAAG

>Exon-2 150-154 bp
GGTTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: