MgSTS856

Genetic marker
Map(s): Not Mapped
Forward primer: gcagatgaaacacaacgccg
Reverse primer: tctctagccctagctctggc
Tm: 0.0
Physical marker
Overgo sequence fw: CGAAGTCGAAGGCCGCCATTAAAG
                ||||||||
Overgo sequence rv:                 GTAATTTCTGGAGCACGTCTACTT
Tm: 66.4
Set: C
Pools: 4,7,14
View Map
Sequence
Unigene: MgU5909 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 --1 bp
T

>Right2 -3 bp
T



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: