MgSTS855

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 78.18cM

Forward primer: GTAAAGCGCCTCCAAAAGG
Reverse primer: CCACCACATTGGAGACAGG
Tm: 59.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5885 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 385-440 bp
ATGGCTGAAAAAGCATGTGTAAAGCGCCTCCAAAAGGAATATAGATCACTCTGCAAG

>Exon-2 441-495 bp
GGAACCTGTCTCCAATGTGGTGGCACGCCCTCATCCAAATAACATCCTCGAGTGGC

>Exon-3 496-534 bp
CATTATGTGTTGGAAGGAAGTCAAGGAACAGCTTTTGCAG

>Exon-4 535-598 bp
GGTGGTTATTACTATGGACATATAAAGTTTCCACCAGAATACCCTTTCAAACCTCCAGGAA
TCAG

>Exon-5 599-660 bp
GTATGACCACTCCAAATGGACGCTTTTTGACAAAAACGAAGATATGCCTGTCTATGAGCGA
CT

>Exon-6 661-700 bp
TTTCATCCCGAGAGTTGGAACCCCATGTGGTCTTCCTCAAG

>Exon-7 701-728 bp
GCATACTGACTGNGCTCCTCTCCTTCATG

>Exon-8 729-769 bp
GATGGACAATAGTCCCACCACGGGCGGCGTCTCAACTTCAGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: