MgSTS854

Genetic marker
Map(s): Not Mapped
Forward primer: GATCCGAAGACCATTTGTGG
Reverse primer: TGCATCTCGATTGTGAATGG
Tm: 60.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5880 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 107-110 bp
XXACC

>Exon-2 111-219 bp
CTGCCAAGTTTTGATCCGAAGACCATTTGTGGTATCGTGAAGAAAAGCTTTATCCACTA
CAACTTTTTCGACTATGCCAGTCGAGTTGTTCTTCCCAAGACTACCTATGC

>Exon-3 220-398 bp
CTAATTCCATGACCAGGTCCACAGTTTATATTCTTCATTTTGATATTCGAGCTGCCATTC
ACAATCGAGATGCA
ATCATCGCCTAAAGATCAAGACACAGAACAGCGGTACTTTACCCT
GTTTTTCTTTTTGTCATAAAACTCGAAGCAAAAATCAAGATCAAGAAAATATCAAAACAC
C

>Exon-4 399-605 bp
CTGTCCCGATATTGCAGTTTTCTAGGACAACATTTGTCGATCCAGTGATGTGAATTCCATC
TGTGTTTGGACTGTCGCCCGGCGAGGAAACTTCCACACCACTCACACGAACCGATTCGCA
TCGAGAAATTACAAAGTGCATCTGTTGGCTGTTTCGAATTGTGATCCCTTTCACTCTTAC
AGCTGAGCTGGCATCTATAGTTAAAGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: