MgSTS853

Genetic marker
Map(s): Not Mapped
Forward primer: TTCGGTGCTCTGTGTATTTCC
Reverse primer: AGATGGGCACTTGAGAAAGG
Tm: 60.1
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5845 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 263-504 bp
ATTCGGACAAATCAGCATACTGCCATGGATTAAATTCTGTTGATTGTACATCACCTGTTTC
AATGGCATCTGAAGAGTCAATGGCATTTCGGTGCTCTGTGTATTTCCCGTTGAAACGG
TATACTTCCAAGTCACCCCATGGTGTAGGTGTGATGTCATCAGTTTGATCGAACCATTTT
GGGGTGAACTGGTCACCTTTTGCTTCTCGGTTTCTCTTTTCAGCTCTTTGTCTCTCCTCC
AAAC

>Exon-2 505-683 bp
CTGCTCTTAGCAGCACCAGCCTTGGAGAGATCGCCTTTCTCAAGTGCCCATCTATCAGG
ACGCAATCTTGAATCTGATGCCAACAACTTCTTGGGTGCAGTTTCAAAGCTGTTCAATTT
ATGCGCAAAGTATGTGAACTGATATTTGTCACCAGGTGGAGTTGCCGCACGACTCCCAAC
C

>Exon-3 684-778 bp
CTCTTTCAGTTCTGTACCAGGAAGAGGTTCCCCTTCCAAATCACATGGCTGATAACTCATT
GACTCGCTCCATTTTCCAGTCATCAATATTTTCGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: