MgSTS852

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 143.17cM

Forward primer: TCTTCTCAGGCGAATCTTCC
Reverse primer: TGGAGGTATGGGGATTAGGG
Tm: 59.5
Physical marker
Overgo sequence fw: GCGCCTAACGGCACCTGGATTAAA
                ||||||||
Overgo sequence rv:                 CCTAATTTGTAGTATAGGTAGTAG
Tm: 64.4
Contig BAC
BAC contig and clones containing marker:
MgFPC232
MG__Bb061G02
MgFPC284
MG__Bb065L10
MgFPC314
MG__Bb092F09
MG__Ba078G04
MG__Bb005L18
MG__Bb042G12
MG__Bb022G20
MG__Bb087D13
MG__Bb038J23
MG__Bb022J19
MG__Bb088K18
MgFPC339
MG__Ba069J03
Set: D2
Pools: 5,10,14
View Map
Sequence
Unigene: MgU5831 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 220-319 bp
ATTATCTTTCTTCGCGCCTAACGGCACCTGGATTAAACATCATATCCATCATCATCTT
CTCAGGCGAATCTTCC
CAATTGGTAAAAGTTTTCAGGTCAATC

>Exon-2 320-445 bp
CTTTCGCCTTTGATCCGTAAAAAGCTGTTCTCTTTTTCTGGGAGAATTTTGAATCTCTATA
GAACCCGTTCCCCCTAATCCCCATACCTCCACTTCTAAAACCGATGCTTCAACTTGTA
AGTATCCC

>Exon-3 446-642 bp
CTGATTGGGGAAAAGGGCGCCATGCTGGTACGTTTTATCAACAGCATGGTGGCGTACAGTA
ACTTTTGCAAAATCCTCGTCAATAAATATTCTTTCATTTCCAATATTTCCTCCAAATGCA
ATTCCCACCGGTTTTGGATGTGCATCGTACAGACCAGTTGGATGCAAATGGCTATAGATG
AAATTTTTCTCTCTTCC

>Exon-4 643-717 bp
CGGAGGTTGTTAATGCACGAAAGACTGGGCTTAAAGCATACAAACTGCCAGAAGTTCCATA
AAACGAGTCCTTAXX



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: