MgSTS851

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)13 27.34cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 23.38cM

Forward primer: AATCGATCGGTTTTGTGAGC
Reverse primer: GCCAAAAGAAAGACCAACACC
Tm: 60.1
Physical marker
Overgo sequence fw: CGACAGGGGTTCTTTCTCTGTAGA
                ||||||||
Overgo sequence rv:                 AGACATCTCCACTATGAGTGTGAC
Tm: 65.4
Set: C
Pools: 4,7,12
View Map
Sequence
Unigene: MgU5782 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 88-98 bp
GTACATGGTCAG

>Exon-2 99-246 bp
GTTTTATGATTTGATAAATATATTTGAGCTCAACGGACTTCCGTCAGAAGATAATCCGTAT
CTGTTCAACGGGGACTTCGTCGACAGGGGTTCTTTCTCTGTAGAGGTGATACTCACACT
G
TTTGCCTTCAATTGTTTGTCTCCCTCAG

>Exon-3 247-495 bp
GCTATACATCTTTCTCGTGGAAACCATGAAAGCAAGAGCATGAATAAGATATATGGTTTTG
AAGGGGAGGTCAGATCGAAGTTGAATGATATATTCGTGGAACTATTTGCAGAAGTGTTCT
GTTGTTTGCCTTTGGCTCACGTCATAAATCAGAAAGTTTTTGTGGTGCACGGTGGCCTTT
TCAGTGTTGACGGTGTTAAGCTCTCTGACATCAGAGCAATCGATCGGTTTTGTGAGCC
CCCCGAGGAGG

>Exon-4 496-621 bp
GGGTTAATGTGTGAGTTGCTGTGGAGTGATCCACAACCTCAGCTTGGGAGGGGACCAAGTA
AGCGTGGTGTTGGTCTTTCTTTTGGCGGTGATGTCACCAAACGATTTTTGCAAGACAA
CAATCTAG

>Exon-5 622-722 bp
GATTTGGTTGTGAGGTCGCATGAAGTTAATGATGAACGTTACGAGATTGAGCACGATGGTA
AACTTATTACGGTTTTTTCTGCCCCACCTTACTGTGATCAG

>Exon-6 723-790 bp
GATGGGTAACAAGGGAGCGTTCATTCGCCTTGAGGCACCGGATCTGAAACCCAATATTGTG
ACTTTTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: