MgSTS850

Genetic marker
Map(s): Not Mapped
Forward primer: GCTTTGGTGATTGGTCTTGG
Reverse primer: CCGACACGAATGATATGAACC
Tm: 60.5
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5778 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 86-152 bp
XXGGCTTTGGTGATTGGTCTTGGTGGCCTTAATCTATTTGGGGTTATATTTCTCGGTAC
CATGTTAAA

>Exon-2 153-221 bp
AGAATATGACATTTAGCCAGACTGGGTTCATATCATTCGTGTCGGAAATATTTCCGCTG
CTTCAGATCTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: