MgSTS85

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 91.47cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 27.39cM

Forward primer: TGGGGTAAACTGAGGAGGAA
Reverse primer: GCGAAGACGTTTAGGTACGC
Tm: 0.0
Physical marker
Overgo sequence fw: CGGATACTATTGGCCGAGTTAACC
                ||||||||
Overgo sequence rv:                 TCAATTGGGCCAACTCTAACACTC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC177
MG__Bb068F13
MgFPC2800
MG__Bb094F16
MgFPC2932
MG__Bb027F16
Set: D2
Pools: 3,9,15
View Map
Sequence
Unigene: MgU672 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 8-674 bp
CTCGGAAGAGAAATCGAAGACGTATACCGAGGGAGTGACAAGGGTATTTTAAAAGACGTGG
AGCTTCTCAAACAAATAACCGAAGCGTCTCGTGGAGCGGTTTATTCGTTCGTGGAGCAAT
CCACAAACGAGAAAGGACAAGTTGTCGGTGTTGGTAATAAGTTGACTTCGATTCTCGGTT
TCGGAATAAACGAGCCGTGGGTCAAATACTTGTCGGACACGAAATTCTACCGAGCCGACA
GAGAGAAGCTCCGAATATTGTTCCAGTTCTTGGGAGAGTGCTTGAAGCTGATTGTTGCGG
ATAACGAGTTGGGTAGTTTGAAGCAAGCGTTAGAAGGGAAGTACGTCGAGCCGGGGCCAG
GTGGCGACCCGATCAGGAATCCTAAAGTGTTGCCGACGGGTAAGAATATCCATGCGTTGG
ACCCGCAGTCGATTCCGACAACCGCCGCCATGCAGAGTGCTATGGTGGTGGTGGATAGGT
TGCTCGAGCGGCAGAAGGCGGACACTGGCGGGAAATATCCGGAGACGGTTGCGCTTGTGC
TTTGGGGTACGGATAATATTAAGACGTACGGTGAGTCGCTTGCTCAGGTGATGTGGATGA
TCGGTGTTAAGCCGGTGGCGGATACTATTGGCCGAGTTAACCCGGTTGAGATTGTGAG
TCTTGAAAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: