MgSTS849

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 59.62cM

Forward primer: TGCATCAGATGTTGCTTTCC
Reverse primer: CTTGACGTGAGCCAACACC
Tm: 59.8
Physical marker
Overgo sequence fw: CTAGTGGATAAGTTTCAGCTCGCC
                ||||||||
Overgo sequence rv:                 TCGAGCGGCTCCTAGGACTAAGAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1194
MG__Ba090F10
MgFPC201
MG__Bb088L24
Set: C
Pools: 4,7,11
View Map
Sequence
Unigene: MgU5771 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 215-256 bp
CAAATCCCTAAACGCCCTATCTCCAATATTCTCTTCATAATCG

>Exon-2 257-320 bp
GCTATGCAGACGGAGGCGTCACCTCTAGTGGATAAGTTTCAGCTCGCCGAGGATCCTGAT
TCTG
T

>Exon-3 321-412 bp
TGTTTCCAAAGGGCGTTCCATGGGTTAGGTACTATGGTAAATATAAGGATTTGAACATCAA
CATTGTTTGCCCTGGAAAAGACACAGTATTGG

>Exon-4 413-519 bp
GGTGTTGACTGCGTTGGCACGGTTTCTGCATCTCTTCTGACTTATGCTTCTATTCAAGCAT
TACAGCCGGACCTTATTATAAATGCAGGGACTTCTGGAGGATTCAAG

>Exon-5 520-594 bp
GGCAAAAGGTGCTTCCGTAGGTGATGTATATCTTGCATCAGATGTTGCTTTCCACGACA
GAAGAATTCCTATCCCT

>Exon-6 595-669 bp
TGTTTTTGACTTATATGGTGTTGGCTCACGTCAAGCATGCTCCACACCTAATCTTGCAG
AGGAGCTGAACTTAAAG

>Exon-7 670-762 bp
GGTCGGAAAATTATCTACTGGTGATTCTTTAGATATGTCCCCACATGACGAAGAAGCCATG
GTGGCTAACGATGCAACCATTAAAGATATGGAG

>Exon-8 763-803 bp
GGGAGCTGCTATTGCTTATGTGGCGGATCTATTTGAAGTGCN



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: