MgSTS848

Genetic marker
Map(s): Not Mapped
Forward primer: TGGTCGATATCTTGGAACTGG
Reverse primer: GCAGCTTGAAAGCTTGATACC
Tm: 59.9
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5750 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 92-106 bp
AAAGAAGGGCAATCAG

>Exon-2 107-249 bp
GGTATTATATCTTCAATTGCTTTCTCTCCCACTGATTCTGGGATGCTGGCTGCGGGTTCCT
ATAGCCAAACTACTGCTATATACAGAGAAGATAATATGGGGCTGTTGTATGTGTTGCATG
GCCAAGAAGGTGGTGTTACCCAA

>Exon-3 250-297 bp
AGTTCAGTTTTCGAAAGATGGCAACTATTTGTACACTGGGGGGCGTAAG

>Exon-4 298-350 bp
GGATCCATATGTGCTATGCTGGGATATTCGCAAAACTGTTGATATTGTCTACAA

>Exon-5 351-435 bp
AACTATATCGATCATCCGAAACTACCAATCAAAGGATACAATTTGATATTGAGCCTCTTG
GTCGATATCTTGGAACTGG
CGGTCAG

>Exon-6 436-502 bp
GGATGGTCTTGTGCATATCTATGATCTCCAGACGGGGGAATGGGTATCAAGCTTTCAAGC
TGC
GCTAG

>Exon-7 503-616 bp
GATACCGTAAATGGTTTTGCTTTCCACCCGTTTCTCCCGATGGCAGCAACTTCATCAGGAC
ATAGACGATTTGCAGGATTATTGGATGACTCTCAAGAAAATAACCCTTTAAATG

>Exon-8 617-653 bp
GGTCATGAAAATTGTTTGTCTGCATGGAGCTTTTATTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: