MgSTS847

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 6.85cM

Forward primer: AATGCTGCTAAAGTCGAAGG
Reverse primer: CCAATGTTGCAGTTGTTTGG
Tm: 57.3
Physical marker
Overgo sequence fw: GGGAAAGCGTGTCATTCGTTGAGC
                ||||||||
Overgo sequence rv:                 GCAACTCGTCGACTCTCCTAAAGT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MlFPC1159
ML__Ba011G09
MlFPC521
ML__Ba088B18
ML__Ba047B03
Set: C
Pools: 4,6,15
View Map
Sequence
Unigene: MgU5748 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 88-152 bp
TGGAGGGAAAGCGTGTCATTCGTTGAGCAGCTGAGAGGATTTCAAGAACTTATTAATCA
AGGGAAG

>Exon-2 153-288 bp
GGTGAGGTACATTGGTGTATCTAATGAAACTTCATACGGAGTTATGGAGTTTGTTAATGC
TGCTAAAGTCGAAGG
ACTACCTAAAATCGTCAGCATCCAGAACAGCTACAGTTTGCTAG
TGAGATGCAAGTTTGAAC

>Exon-3 289-467 bp
CTTGATCTGGTTGAAGTTTGCCACCCAAACAACTGCAACATTGGCTTGCTTGCTTATTC
TCCACTAGCAGGTGGAGCATTATCAGGGAAATATCTCGACATTACTTCCGAAGCAGCAAA
AACGGGGAGGTTTCAACTCTTCCCCGGGTATATGGAAAGATACAATAAATCGATTTCTAA
G

>Exon-4 468-697 bp
GGAAGCTACGACAAAATATCTTGAAGTGGCAGAAAAACACGGACTGAGTCTCGTGGAATTA
GCTCTTGCATTCGCGCGAGACAGATCGTTCGTGACGAGTTCGATAATAGGTGCTACTTCT
ATTGAACAGTTAAGACAAGATATTGATGCCTTTCTTACGACCGAGCGGCCTTTGTCACCG
CAAGTTGTGGCGGATGTTGAAAATGTCTTCAAGAGGTACAAAGATCCAGN



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: