MgSTS846

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 27.42cM
M. guttatus IM62_x_DUN RILs(2009)10 73.59cM

Forward primer: GATCGCAACACACTTTCTCG
Reverse primer: AAGGGACGGTTTGATGTCC
Tm: 59.4
Physical marker
Overgo sequence fw: CTTCTCTTCTCAAAACGCCGATTC
                ||||||||
Overgo sequence rv:                 CGGCTAAGAAGGGCGTGTAGACGA
Tm: 65.4
Set: D2
Pools: 3,7,14
View Map
Sequence
Unigene: MgU5739 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 119-210 bp
ATGTTCGAGAGCAGCCAATTTGATTCTCAGGCGGGGAGCGGCGGCGGCTTCTTCTCTTCT
CAAAACGCCGATTCTTCCCGCACATCTGCT
AAG

>Exon-2 211-318 bp
GAGTCGAGATAATCAACCGATGTGTCCTGTTACGGTGAAGCAAATAGTCGAAGCGAGTTCC
GCCGACGACAAGTCGAATTTCCTCATCGACGGAATTGATGTGTACAAT

>Exon-3 319-416 bp
TGTAAAATTGGTTGGAATGGTATTCGAAAAATCAGCTAGAAATACTGATGCCTCGTTTGTC
ATCGACGATGGCACAGGGCGTATTGCTTGCCACAGATG

>Exon-4 417-458 bp
GGATAAATGATCCACAAGACACGGAGGAAGTGGAAGAATTAAT

>Exon-5 459-536 bp
TGGACGGTATGTATGTACGTGTTCACGGGCATTTGAAGACTTTTCAGGCGAAAAAACAAGT
AGTCGTTTTCGCAATCAG

>Exon-6 537-615 bp
GGCCCGTGAACGATTACAACGAGATCGCAACACACTTTCTCGAATGTATACATGCGCAC
TGCTGCAACAATAAATCACAG

>Exon-7 616-693 bp
GAACAATGGTTCTTCTGCTCCCGCAGCTTCGACAGCAGTTGCGACTCANAGTGGACATCA
AACCGTCCCTT
CAACTCAA

>Exon-8 694-770 bp
AGTTTCTCAAGAGTACAATGTGGATGGACTAGGGAGCATCGATAAGATGGTTCTAGACTAT
CTCCAGTTACCTTCCTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: