MgSTS844

Genetic marker
Map(s): Not Mapped
Forward primer: GACATTCATCCAACAGATATTGC
Reverse primer: CTGAGCGCAATGATGACC
Tm: 58.5
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5733 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 105-265 bp
CAGGTGGAGCTAGCGAACTATTTATATGATCAATTGTGCTCAGTACCCAATGTGCGTGTGT
ATGGGCCAGCTCCTTCGAGAACCGTGGAAAGAGCAGCACTCTGCTCTTTCAACGTGGAC
GACATTCATCCAACAGATATTGC
TACTTTTCTTGACCAACAG

>Exon-2 266-430 bp
GTGTTGCGATTAGATCGGGTCATCATTGCGCTCAGCCCCTTCATCGCCACTTGGGAGTG
AATGCAAGTGCGCGGGCAAGTCTTTATTTCTATAACACCAAAGATGATGTCGATGTTTTC
ATTCTGGCTCTCAAAGACACCATTAGCTTTTTTGCATCGTTTAAGTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: