MgSTS843

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 32.54cM

Forward primer: CTGTGGATGGTTCGGATAGG
Reverse primer: AGGCTGTTAAGCATGGTTGG
Tm: 60.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5732 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 85-126 bp
XTCAACTCATTGGACGTAAAATACGTTCTTGTAGTTTTTGGAG

>Exon-2 127-224 bp
GGTCTTGTTGGATATCCAAGTGATGACATTAACAAGTTTCTGTGGATGGTTCGGATAGG
TGGAGGTGTATTTCCTCACATAAAGGAACCTGATTATTTG

>Exon-3 225-304 bp
GAGAGATGGTCAGTACAGAATCGATGCTCAAGCAACGCCAACCATGCTTAACAGCCTCA
TGTACAAACTTTCATATTACAG

>Exon-4 305-392 bp
GATTTGTCGAGACGGATGGTAGAGGCTTTGACCGGGTGAGACACACTGAAATCGGAAAGAA
GCATTTCAAACTTACCCATTTTGAAGAG

>Exon-5 393-482 bp
GGTATTCACTACACATCATTGGATGGTCCGTCTTTACAAACTGAAATCTCCCAAGAACAGA
ATCCGTGGGAAGACCAAGAAATCTAAATCG

>Exon-6 483-541 bp
GAAAGCTACCACCACAACAAGCTCAAAAAGAATCGGAGCAAGAAAGAAGAATCCTTGGCA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: