MgSTS842

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 90.85cM

Forward primer: ATGAATAAGCTGGGCAGAGG
Reverse primer: TCTAGGTGCCTTGTGTCAGC
Tm: 59.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5730 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 263-326 bp
ATGAATAAGCTGGGCAGAGGTCAGCGTGACAAATTGCAGCAGTTCATGTCGATTACTGGC
GCAAG

>Exon-2 327-463 bp
GTGAAAAAGTAGCTGTCCAGGCTTTGAAATCCAGCGATTGGCAATTCGAAGGAGCATTCGA
CTTATTTTACACCAATTCTAATGTCAAGTCGGTTGCTGACACAAGGCACCTAGAGGAG
CTTTACAATAGATACAAAG

>Exon-3 464-522 bp
GATCCCTATGCTGATATGATTTTGGCTGATGGAATATCTGTCATGTGTAATGACCTTCAG

>Exon-4 523-546 bp
GGTTGATCCTCAAGATATTGTAACA

>Exon-5 547-629 bp
ATTGGTGATCTCGTGGCATATGAAGGCTGCTACAATGTGTGAATTCTCAAAGCCGGAGTTT
ATTGGTGGATTACAATCTCTTGG

>Exon-6 630-694 bp
GGATCGATTCGCTGGAGAAGTTCAGAGAAAGAATACCATTTATGCGTGCTGAAATGAAAGA
CGAGC

>Exon-7 695-744 bp
CANAAGTTCCGAGATATCTATAACTTTGCATTTGGCTGGGCAAAAGAGAAG

>Exon-8 745-794 bp
GGGTCAGAAGTCTTTGGCATTGGATACTGNCATTGGAATGTGGCAGTTGCT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: