MgSTS841

Genetic marker
Map(s): Not Mapped
Forward primer: TTGCTTTCAAAGTTGATGTCG
Reverse primer: GCATCTAGTTTTAGCCGTCTCG
Tm: 59.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5716 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 300-430 bp
AAGGTTCATACCATGTGAGGCTACCCATGATCAAATACTTACCCGGAAGATTTCCGGCAGA
CGGAGCGAGGTATGTGATTTTCTTGCTTTCAAAGTTGATGTCGGTAATCCAGATGAAC
CCAGCAACATTAC

>Exon-2 431-666 bp
CTGGAAATAATTTCATCAGGTTCTTTAGCAAACGAGACGGCTAAAACTAGATGCAACAA
ATCTTGGTTAACAGTAACTGGAATCAATCTTGTGGGATCTGCAGCCGGTTCTGCACCAAC
TGGCAAAGCAAAGCGTGGGGCCTGGGGTCCACCACCCACTCGATAAATGTACAAGTCACT
GAAACTTACGATGTTAGAATGTGGCGAAAGGTCATTTGCTAGTCCATAGAAATATTCA

>Exon-3 667-782 bp
ACGTATTCTAAAGGCTCTGGACTTCTGCCGGACTTTGGCATTCCTAGAGACAACACCACCC
GATTTCTGAAGTTTCACCACATCTACGTTAGCTTTGTTTTTCAGAACATCTTTTAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: