MgSTS840

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 62.88cM

Forward primer: GAACAAGCTGCTCCTTCAGC
Reverse primer: CCGCAATAGATTGGGAAGG
Tm: 60.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5696 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 183-283 bp
ATGGCGAACGATGCGGATATGAGTGGTTGGACCGATCTTCTGCATTCCTCTTCGAAGCTTA
TCGAACAAGCTGCTCCTTCAGCTCAGTTTCCGCCGCTTCAG

>Exon-2 284-375 bp
GAGGAATTTGGATCAGTTGGAGGCTCTGTCGAAGAAGCTCAAGGCAAAAACCCTGCGAGCC
GAAGCTCCTTCCCAATCTATTGCGGCGACTAG

>Exon-3 376-442 bp
GGCTATTAGCTCGAGAGGGGCTAAATGCAGAGCAGCTTGCTCGTGATCTCAAGTCATTTGA
GCTAAAG

>Exon-4 443-502 bp
GACAACATTCGAAGATGTCTTTCCAGCGGAGGCGACGACAGTCGAAGAGTATCTTCAGCAG


>Exon-5 503-592 bp
GGTCCATGAAATGACAATGCTCTCAGCTGTTCAGGAAGCTCAGAAGGATAATCTTAGAAGT
TTCAATGATTATATGATGTCAGTTCTGGAG

>Exon-6 593-783 bp
GGAGGACTGGCAGAAGGAAAAGAGGGACTTTCTTCAGAGCTTGAGCCGAATTTCGACCCTA
CCCAGAACTGATATTCGTGATTCTAATAGTGGGGTTAGTCGGCAGGGTCAAATAGTGCCT
ATGACTTCCAGAAGTGGGGTTTCATCTGCTCCATCTAGTTTGGAGCCTGCACTGTTGGCT
AATAACCCTGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: