MgSTS84

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 30.35cM
M. guttatus IM62_x_DUN RILs(2009)8 8.21cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 24.55cM

Forward primer: CCACCGAAGAAGTTGAAACC
Reverse primer: GCCTTAATAGGACCCCCAAC
Tm: 0.0
Physical marker
Overgo sequence fw: CAAAGCTGCCCTAATCCACCGAAG
                ||||||||
Overgo sequence rv:                 GTGGCTTCTTCAACTTTGGCCCTT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2992
MG__Ba009J16
MG__Bb047O04
MG__Ba082N01
MG__Ba091E09
MG__Ba020I11
MG__Bb076E13
MG__Bb026B04
MG__Bb080H06
MG__Ba093N04
MG__Bb094M21
MG__Ba014C07
MG__Ba082D18
MG__Bb001I14
MG__Bb066O16
MG__Bb079C20
MG__Ba036G19
MG__Ba087O12
MG__Bb085E06
MlFPC1
ML__Ba063F01
MlFPC672
ML__Ba091E19
ML__Ba095J09
ML__Ba082A08
ML__Ba058F19
MlFPC777
ML__Ba067O17
Set: B / C
Pools: 1,7,11 / 5,6,14
View Map
Sequence
Unigene: MgU667 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 8-579 bp
GGAGAAACAAATCAAGAATCCGGCCGCGATGCGAGGCGGGCACCGATGGTGACATTCTGCG
ATATCGAGTCGGACGATGAAATTACTAACGAGGAGTTTAGTCGGTCTGAATCCGAGGTTG
TTAGAGCTAATAATAAGAGAGAGCCTGCGGTTAAGGTAAGAAAAGGGGCGTGTTATCGGT
GCTTGAAAGGTAATAGATTTACCGAAAAAGAGGTGTGCATGGTTTGCGACGCCAAGTACT
GCACTAATTGCGTGCTTAGGGCAATGGGGTCCATGCCCGAGGGTAGAAAATGCGTGACTT
GCATTGGATACTCAATCGACGAGTCGAAGCGGTGCTATTTGGGGAAATGTTCTAGAATGC
TTAAGCGATTGCTTAATGATTTGGAAGTTCGGCAAATTATGAAGGCTGAGAAATTGTGTG
AAGTGAATCAATTGCCTTCCGAGTATATTGTTGTGAACGGTAGCCCTCTTTATCAAGAGG
AGCTTATTATGCTGCAAAGCTGCCCTAATCCACCGAAGAAGTTGAAACCGGGAAAT
TATTGGTACGACAAAGTATCTGGTCTTTGGGGAAAG

>Exon-2 580-668 bp
GGAGGGGCAAAAGCCTGCACAAATTATTAGCCCTCATCTCAATGTTGGGGGTCCTATTAA
GGC
GGATGCTAGTAACGGGAACACACAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: