MgSTS838

Genetic marker
Map(s): Not Mapped
Forward primer: TGTTCAGCTGCTGGGTAGG
Reverse primer: TCCTCGTGATCCAACACTCC
Tm: 60.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5625 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 124-252 bp
ATGGGGAGAAGAATTCTGAACGATGCCTTGCGAACAATCGTCAATGCAGAAAAGAGAGGTT
TCGCTTCCACAGAGCTCAAGCCCATCTCTAATGTCATGTCTTCTTTCCTACAAATCATGA
AACACAGAG

>Exon-2 253-413 bp
GGTTACATTAAAGATTTTCAAGTGCATGATCCACATAGAGTAGGGAAGATAACTGTTCAG
CTGCTGGGTAGG
GTTAAAGATTGTAGGGCTATCACTTACCGACAAGATATTAAGTCTCA
TTACATCGAGAATTACAAAACCCGTACTCTTCCGACACATCAG

>Exon-3 414-511 bp
GTGGGGCTATGTTGTAATTACAACACCAAATGGAGTGTTGGATCACGAGGAGGCTATTC
GACAAAACGTTGGTGGTCAAGTGCTTGGATACTTCTACTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: