MgSTS837

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 105.03cM

Forward primer: AATGACGCACGATCTCTCG
Reverse primer: GGAACCCCTATCATCACTTTCC
Tm: 60.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5601 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 387-624 bp
TCCTGTGCATTTGAGCAATGATATTATTTGAGTTTCCAGCATAAATGACGCACGATCTCT
CG
AACCAGCTGCCTTCGATTTTGAAGTCGCATACATCTTCTTTGGTGTTAGCAGCCATG
AATACATCTAACTTGGTCTTCATTTGAAGGAGTGAAGACTTCCTCACACTGAAAAGCATA
TCCTTTGCATTTGTACTCTCTCCTCTAAACACTTGCCATCTTTGATGTGCAGAGAGCAGC


>Exon-2 625-791 bp
CTTTTGCTGGAAAGTGATGATAGGGGTTCCGGCAGCATCAAGCAAGACGCGGCGATCGT
GGATGCTGAGGAGTTTGCCTTTGATTCTGAACATGATGTTGCCATTAACATCGGTCACTC
CGAAAGTTCCTTCAGATAAAGTCATCAGTTTACGAACGATGGTGAGATC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: