MgSTS836

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 114.78cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 36.22cM

Forward primer: CTGTTCTCTTCGGAATACGC
Reverse primer: AGGGCTATCACTGGATGTGG
Tm: 57.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5551 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 393-516 bp
ATTATTCACTGTCACTGCCAGTATCTAAAAAGCTGAAATCCGTCTGTCCGTCGAGACGTAT
GAAAAGTGTTCCACTGTTCTCTTCGGAATACGCTATACCTTCTTTCTTTAGAAGATTA
ATAACC

>Exon-2 517-587 bp
CGAGTTCTTCAGCTTTGACCTGCCAACACCATGGCTCCCACATCCAGTGATAGCCCTAA
ATGATCGCACAGA

>Exon-3 588-694 bp
ATTGCACGAATGCTCCAAAGAGAAGATGGAGCTTCAATAGCTTCATTCCTTGTTTAATATG
TTGTCCATGGAGATCAATCGTTATCATGTTTTCTATACTTTTGTTTC

>Exon-4 695-762 bp
CTAGCAGTAAATATATTCTGGCTTGCCTTTTCGTCTGCCTCTCGAGCCATTTTACTCTTTA
ACCTCCCC

>Exon-5 763-809 bp
CTGCTCAGAAAGGAAAGATGCATATTCTTTCTCACCAGTTGTGTACGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: