MgSTS835

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 76.88cM

Forward primer: CAAAAACTGCACAGAATGTCG
Reverse primer: ACCCTGAATTCCACCGTACC
Tm: 59.4
Physical marker
Overgo sequence fw: CTTTCCCACAGAAGGGCTGTTAGC
                ||||||||
Overgo sequence rv:                 GACAATCGTGTCTTCTTCCTCTTG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC103
MG__Ba012D17
MlFPC333
ML__Ba014H12
MlFPC671
ML__Ba007N17
ML__Ba096N21
ML__Ba094A21
Set: C
Pools: 4,6,12
View Map
Sequence
Unigene: MgU5527 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 86-270 bp
XTGGCTAGCTGGCTAGAAGATGCCAGGCAGCATGCAAATCCAAACATGTCGATTATGCTGA
TAGGCAACAAATGTGACCTTTCCCACAGAAGGGCTGTTAGCACAGAAGAAGGAGAACA
ATTTGCAAAAGAAAACGGACTCATTTTCATGGAAGCATCTGCAAAAACTGCACAGAATG
TCG
AGGAG

>Exon-2 271-428 bp
GGCATTTATCAAAACTGCTGCGACAATATACAAGAAGATTCAAGATGGAGTCTTTGACGTT
TCAAATGAGTCGTACGGAATAAAAGTTGGGTACGGTGGAATTCAGGGTCCGTCTGGTG
GCAGGGATGGTAATTCTTCACAAGGTGGAGGTTGTTGCAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: