MgSTS834

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 137.59cM
M. guttatus IM62_x_DUN RILs(2009)14 18.58cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 15.90cM

Forward primer: GTTACTGGGCAGCTTCTTGG
Reverse primer: TAGCACCTTCCGCTTCAACC
Tm: 59.9
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5514 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 183-185 bp
ACTG

>Exon-2 186-262 bp
GCGACGCGGTCGTTTTTGCAAGTGGCAGCGACAGAGGAGGCCACGCCGCCTCTCAGAGTTG
TTCAGATTGAAGGATTG

>Exon-3 263-379 bp
GGTTATTTTGAAGATAATTAAGCACTGCAAGGAGTTTTCTCCCGCCCTTGTTACTGGGCA
GCTTCTTGG
ATTGGATGTTGGTAGTGTTCTAGAAGTTACTAATTGTTTCCCTTTCCCG

>Exon-4 380-483 bp
GATCCGTGAGGAAGATGAAGAGGTTGAAGCGGAAGGTGCTAATTATCAGCTTGAAATGA
TGAGATGTCTGAGAGAGGTTAATGTTGACAACAACACCGTTGGATG

>Exon-5 484-550 bp
GGTACCAATCAACTTTATTTGGTTCTTTCCAGACAGTTGAATTGATAGAGACTTTTATGAA
CTATCAG

>Exon-6 551-684 bp
GGAAAATATAAGACGTTGTGTGTGCATCATATATGATCCATCAAGAGCTAACCAAGGTGTA
TTAGCTTTGAAGGCACTGAAGCTTTCAGACTCATTCATGGAGCTCTACCGTACTAATAAC
TCCACTGGGGAGAA

>Exon-7 685-733 bp
AGTTGAGGGAGAAGAATCTTTCATGGGTGGATATCTTTGAAGAGATTCCC

>Exon-8 734-786 bp
CATCAAGGTGTCAAATTCTGCTCTTATCAGTGCTTTCATGACTGAGCTTGANGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: